EMAIL THIS PAGE TO A FRIEND

BCR

breakpoint cluster region

125 Gene Product Result for
Synonyms: ALL BCR1 CML D22S11 D22S662 PHL
UniProtKB ID: P11274, P78501, Q12842, Q4LE80, Q6NZI3
Gene ID:
Human(613) Summary: A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(110279) breakpoint cluster region
Rat(309696) breakpoint cluster region
Zebrafish(568320) breakpoint cluster region
domestic cat(101101671) breakpoint cluster region
cow(789892) breakpoint cluster region
dog(607482) breakpoint cluster region
chicken(416952) breakpoint cluster region
Domestic Rabbit(100339436) breakpoint cluster region
naked mole-rat(101716702) breakpoint cluster region
domestic guinea pig(100718992) breakpoint cluster region
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300457 Anti-BCR (Ab-177) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
SAB1300809 Anti-BCR (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA pricing
SAB1401029 Anti-BCR antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA038337 Anti-BCR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4502657 Anti-BCR antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB4502658 Anti-BCR, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4504353 Anti-phospho-Bcr (pTyr177) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300160 Anti-phospho-BCR (pTyr177) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4504084 Anti-phospho-Bcr (pTyr360) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301469 Anti-phospho-Bcr (pTyr360) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB1402126 Monoclonal Anti-BCR antibody produced in mouse clone 2E5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0233 Rabbit anti-BCR Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, human
flow cytometry, immunofluorescence, immunoprecipitation, proximity ligation assay pricing
PLA0234 Rabbit anti-BCR Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, primate, zebrafish, turkey, guinea pig, human, mouse, horse, rat, toad, chicken, rabbit
flow cytometry, immunofluorescence, immunoprecipitation, proximity ligation assay, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1059 MCF10A CELLS BCR (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004327 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004327 Rosetta Predictions human pricing
NM_021574 Rosetta Predictions human pricing
XM_001079915 Rosetta Predictions rat pricing
XM_228091 Rosetta Predictions rat pricing
NM_001081412 Rosetta Predictions mouse pricing
XM_898043 Rosetta Predictions mouse pricing
XM_983429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151870 predicted 3185
2 SASI_Hs01_00151871 predicted 2485
3 SASI_Hs01_00151872 predicted 2838
4 SASI_Hs01_00151873 predicted 3243
5 SASI_Hs01_00151874 predicted 1753
6 SASI_Hs01_00151876 predicted 2494
7 SASI_Hs01_00151877 predicted 2436
8 SASI_Hs02_00337366 predicted 2469
9 SASI_Hs01_00151878 predicted 2425
10 SASI_Hs01_00151869 predicted 2402
11 SASI_Hs01_00151875 predicted 3142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067296 predicted 3183
2 SASI_Hs01_00067297 predicted 2484
3 SASI_Hs01_00067298 predicted 2839
4 SASI_Hs01_00067299 predicted 3244
5 SASI_Hs01_00067300 predicted 1750
6 SASI_Hs01_00067302 predicted 2497
7 SASI_Hs01_00067303 predicted 2437
8 SASI_Hs02_00354935 predicted 2469
9 SASI_Hs01_00067304 predicted 2426
10 SASI_Hs01_00067295 predicted 2405
11 SASI_Hs01_00067301 predicted 3144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365964 predicted 859
2 SASI_Rn02_00365965 predicted 2871
3 SASI_Rn02_00365966 predicted 2291
4 SASI_Rn02_00365967 predicted 2888
5 SASI_Rn02_00365968 predicted 1584
6 SASI_Rn02_00365969 predicted 3663
7 SASI_Rn02_00365970 predicted 2637
8 SASI_Rn02_00365971 predicted 598
9 SASI_Rn02_00365972 predicted 1648
10 SASI_Rn02_00365973 predicted 2442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384921 predicted 870
2 SASI_Rn02_00384922 predicted 2892
3 SASI_Rn02_00384923 predicted 2306
4 SASI_Rn02_00384924 predicted 2906
5 SASI_Rn02_00384925 predicted 1601
6 SASI_Rn02_00384926 predicted 3685
7 SASI_Rn02_00384927 predicted 2659
8 SASI_Rn02_00384928 predicted 612
9 SASI_Rn02_00384929 predicted 1662
10 SASI_Rn02_00384930 predicted 2460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298131 predicted 974
2 SASI_Mm02_00298132 predicted 3240
3 SASI_Mm02_00298133 predicted 2756
4 SASI_Mm02_00298134 predicted 3192
5 SASI_Mm02_00298135 predicted 1994
6 SASI_Mm02_00298136 predicted 1942
7 SASI_Mm02_00298137 predicted 2995
8 SASI_Mm02_00298138 predicted 2427
9 SASI_Mm02_00298139 predicted 2804
10 SASI_Mm02_00298140 predicted 3089
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268132 predicted 973
2 SASI_Mm01_00268133 predicted 2604
3 SASI_Mm01_00268134 predicted 3122
4 SASI_Mm01_00268135 predicted 2764
5 SASI_Mm01_00268136 predicted 3064
6 SASI_Mm01_00268137 predicted 1999
7 SASI_Mm01_00268138 predicted 1940
8 SASI_Mm01_00268139 predicted 2427
9 SASI_Mm01_00268140 predicted 2810
10 SASI_Mm01_00268141 predicted 3077
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_983429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202932 predicted 980
2 SASI_Mm01_00202933 predicted 3252
3 SASI_Mm01_00202934 predicted 2767
4 SASI_Mm01_00202935 predicted 3188
5 SASI_Mm01_00202936 predicted 2005
6 SASI_Mm01_00202937 predicted 1938
7 SASI_Mm01_00202938 predicted 3005
8 SASI_Mm01_00202939 predicted 2430
9 SASI_Mm01_00202940 predicted 3095
10 SASI_Mm01_00202941 predicted 3211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081412
VALIDATED
BCR MISSION shRNA Bacterial Glycerol Stock
breakpoint cluster region
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-1898s21c1
Sequence:CCGGTACCGAGCCTTTGTGGATAACCTCGAGGTTATCCACAAAGGCTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-2639s21c1
Sequence:CCGGAGTCGCAACGGCAAGAGTTACCTCGAGGTAACTCTTGCCGTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-696s21c1
Sequence:CCGGTGGTGAAGGTCAACGACAAAGCTCGAGCTTTGTCGTTGACCTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-4030s21c1
Sequence:CCGGAGACCCTTCCTGCGGTGTAATCTCGAGATTACACCGCAGGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-2524s21c1
Sequence:CCGGACGAGAGAAGAGAGCAAATAACTCGAGTTATTTGCTCTCTTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081412.2-1492s21c1
Sequence:CCGGGCTGCCCTACATCGATGATTCCTCGAGGAATCATCGATGTAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081412
VALIDATED
BCR MISSION shRNA shRNA Plasmid DNA
breakpoint cluster region
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-1898s21c1
Sequence:CCGGTACCGAGCCTTTGTGGATAACCTCGAGGTTATCCACAAAGGCTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-2639s21c1
Sequence:CCGGAGTCGCAACGGCAAGAGTTACCTCGAGGTAACTCTTGCCGTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-696s21c1
Sequence:CCGGTGGTGAAGGTCAACGACAAAGCTCGAGCTTTGTCGTTGACCTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-4030s21c1
Sequence:CCGGAGACCCTTCCTGCGGTGTAATCTCGAGATTACACCGCAGGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-2524s21c1
Sequence:CCGGACGAGAGAAGAGAGCAAATAACTCGAGTTATTTGCTCTCTTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081412.2-1492s21c1
Sequence:CCGGGCTGCCCTACATCGATGATTCCTCGAGGAATCATCGATGTAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081412
VALIDATED
BCR MISSION shRNA Lentiviral Transduction Particles
breakpoint cluster region
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-1898s21c1
Sequence:CCGGTACCGAGCCTTTGTGGATAACCTCGAGGTTATCCACAAAGGCTCGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-2639s21c1
Sequence:CCGGAGTCGCAACGGCAAGAGTTACCTCGAGGTAACTCTTGCCGTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-696s21c1
Sequence:CCGGTGGTGAAGGTCAACGACAAAGCTCGAGCTTTGTCGTTGACCTTCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-4030s21c1
Sequence:CCGGAGACCCTTCCTGCGGTGTAATCTCGAGATTACACCGCAGGAAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081412.2-2524s21c1
Sequence:CCGGACGAGAGAAGAGAGCAAATAACTCGAGTTATTTGCTCTCTTCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081412.2-1492s21c1
Sequence:CCGGGCTGCCCTACATCGATGATTCCTCGAGGAATCATCGATGTAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004327
VALIDATED
BCR MISSION shRNA Bacterial Glycerol Stock
breakpoint cluster region
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-2463s21c1
Sequence:CCGGAGAGCCAGAAGCAACAAAGATCTCGAGATCTTTGTTGCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004327.3-4803s21c1
Sequence:CCGGCCCTCACTGTTGTATCTTGAACTCGAGTTCAAGATACAACAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-3473s21c1
Sequence:CCGGCGAGGAATTTGAGATAGAGCTCTCGAGAGCTCTATCTCAAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-3240s21c1
Sequence:CCGGCTGACCAACTCGTGTGTGAAACTCGAGTTTCACACACGAGTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3132s1c1
Sequence:CCGGCTGACCAACTCGTGTGTGAAACTCGAGTTTCACACACGAGTTGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3011s1c1
Sequence:CCGGCAAGAGTTACACGTTCCTGATCTCGAGATCAGGAACGTGTAACTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-2355s1c1
Sequence:CCGGAGAGCCAGAAGCAACAAAGATCTCGAGATCTTTGTTGCTTCTGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3365s1c1
Sequence:CCGGCGAGGAATTTGAGATAGAGCTCTCGAGAGCTCTATCTCAAATTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3023s1c1
Sequence:CCGGGTTCCTGATCTCCTCTGACTACTCGAGTAGTCAGAGGAGATCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004327.3-952s1c1
Sequence:CCGGGCGAGGGTTCTCCGGGTAAGGCTCGAGCCTTACCCGGAGAACCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004327.3-2387s1c1
Sequence:CCGGCTACGGAGTTGCCATGGAAATCTCGAGATTTCCATGGCAACTCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004327.3-4803s1c1
Sequence:CCGGCCCTCACTGTTGTATCTTGAACTCGAGTTCAAGATACAACAGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194953    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004327.3-5444s1c1
Sequence:CCGGCAGATCCAGATACCTAATAAGCTCGAGCTTATTAGGTATCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004327
VALIDATED
BCR MISSION shRNA shRNA Plasmid DNA
breakpoint cluster region
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-2463s21c1
Sequence:CCGGAGAGCCAGAAGCAACAAAGATCTCGAGATCTTTGTTGCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004327.3-4803s21c1
Sequence:CCGGCCCTCACTGTTGTATCTTGAACTCGAGTTCAAGATACAACAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-3473s21c1
Sequence:CCGGCGAGGAATTTGAGATAGAGCTCTCGAGAGCTCTATCTCAAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-3240s21c1
Sequence:CCGGCTGACCAACTCGTGTGTGAAACTCGAGTTTCACACACGAGTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3132s1c1
Sequence:CCGGCTGACCAACTCGTGTGTGAAACTCGAGTTTCACACACGAGTTGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3011s1c1
Sequence:CCGGCAAGAGTTACACGTTCCTGATCTCGAGATCAGGAACGTGTAACTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-2355s1c1
Sequence:CCGGAGAGCCAGAAGCAACAAAGATCTCGAGATCTTTGTTGCTTCTGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3365s1c1
Sequence:CCGGCGAGGAATTTGAGATAGAGCTCTCGAGAGCTCTATCTCAAATTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3023s1c1
Sequence:CCGGGTTCCTGATCTCCTCTGACTACTCGAGTAGTCAGAGGAGATCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004327.3-952s1c1
Sequence:CCGGGCGAGGGTTCTCCGGGTAAGGCTCGAGCCTTACCCGGAGAACCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004327.3-2387s1c1
Sequence:CCGGCTACGGAGTTGCCATGGAAATCTCGAGATTTCCATGGCAACTCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004327.3-4803s1c1
Sequence:CCGGCCCTCACTGTTGTATCTTGAACTCGAGTTCAAGATACAACAGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194953    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004327.3-5444s1c1
Sequence:CCGGCAGATCCAGATACCTAATAAGCTCGAGCTTATTAGGTATCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004327
VALIDATED
BCR MISSION shRNA Lentiviral Transduction Particles
breakpoint cluster region
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-2463s21c1
Sequence:CCGGAGAGCCAGAAGCAACAAAGATCTCGAGATCTTTGTTGCTTCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004327.3-4803s21c1
Sequence:CCGGCCCTCACTGTTGTATCTTGAACTCGAGTTCAAGATACAACAGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-3473s21c1
Sequence:CCGGCGAGGAATTTGAGATAGAGCTCTCGAGAGCTCTATCTCAAATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004327.3-3240s21c1
Sequence:CCGGCTGACCAACTCGTGTGTGAAACTCGAGTTTCACACACGAGTTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3132s1c1
Sequence:CCGGCTGACCAACTCGTGTGTGAAACTCGAGTTTCACACACGAGTTGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3011s1c1
Sequence:CCGGCAAGAGTTACACGTTCCTGATCTCGAGATCAGGAACGTGTAACTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-2355s1c1
Sequence:CCGGAGAGCCAGAAGCAACAAAGATCTCGAGATCTTTGTTGCTTCTGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3365s1c1
Sequence:CCGGCGAGGAATTTGAGATAGAGCTCTCGAGAGCTCTATCTCAAATTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004327.x-3023s1c1
Sequence:CCGGGTTCCTGATCTCCTCTGACTACTCGAGTAGTCAGAGGAGATCAGGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004327.3-952s1c1
Sequence:CCGGGCGAGGGTTCTCCGGGTAAGGCTCGAGCCTTACCCGGAGAACCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004327.3-2387s1c1
Sequence:CCGGCTACGGAGTTGCCATGGAAATCTCGAGATTTCCATGGCAACTCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004327.3-4803s1c1
Sequence:CCGGCCCTCACTGTTGTATCTTGAACTCGAGTTCAAGATACAACAGTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194953    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004327.3-5444s1c1
Sequence:CCGGCAGATCCAGATACCTAATAAGCTCGAGCTTATTAGGTATCTGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125706
VALIDATED
BCR MISSION shRNA Bacterial Glycerol Stock
breakpoint cluster region
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2472s1c1
Sequence:CCGGGCTGTTAATGTCTCCCAGCATCTCGAGATGCTGGGAGACATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-3052s1c1
Sequence:CCGGGTCATCGACATGAATGGAATTCTCGAGAATTCCATTCATGTCGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2028s1c1
Sequence:CCGGCCTCCGAATCTCTCAGAACTTCTCGAGAAGTTCTGAGAGATTCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2640s1c1
Sequence:CCGGGCTGACCAACTCATGTGTAAACTCGAGTTTACACATGAGTTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125706.5-769s1c1
Sequence:CCGGCTGAAGGACAACCTAATAAATCTCGAGATTTATTAGGTTGTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125706
VALIDATED
BCR MISSION shRNA shRNA Plasmid DNA
breakpoint cluster region
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2472s1c1
Sequence:CCGGGCTGTTAATGTCTCCCAGCATCTCGAGATGCTGGGAGACATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-3052s1c1
Sequence:CCGGGTCATCGACATGAATGGAATTCTCGAGAATTCCATTCATGTCGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2028s1c1
Sequence:CCGGCCTCCGAATCTCTCAGAACTTCTCGAGAAGTTCTGAGAGATTCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2640s1c1
Sequence:CCGGGCTGACCAACTCATGTGTAAACTCGAGTTTACACATGAGTTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125706.5-769s1c1
Sequence:CCGGCTGAAGGACAACCTAATAAATCTCGAGATTTATTAGGTTGTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125706
VALIDATED
BCR MISSION shRNA Lentiviral Transduction Particles
breakpoint cluster region
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2472s1c1
Sequence:CCGGGCTGTTAATGTCTCCCAGCATCTCGAGATGCTGGGAGACATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-3052s1c1
Sequence:CCGGGTCATCGACATGAATGGAATTCTCGAGAATTCCATTCATGTCGATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2028s1c1
Sequence:CCGGCCTCCGAATCTCTCAGAACTTCTCGAGAAGTTCTGAGAGATTCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_125706.5-2640s1c1
Sequence:CCGGGCTGACCAACTCATGTGTAAACTCGAGTTTACACATGAGTTGGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_125706.5-769s1c1
Sequence:CCGGCTGAAGGACAACCTAATAAATCTCGAGATTTATTAGGTTGTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks