EMAIL THIS PAGE TO A FRIEND

BCRP2

breakpoint cluster region pseudogene 2

5 Gene Product Result for
Synonyms: BCR-2 BCR2 BCRL2
Species: Human BCRP2(400892)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207474 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065935 predicted 483
2 SASI_Hs01_00065936 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207474
BCRP2 MISSION shRNA Bacterial Glycerol Stock
breakpoint cluster region pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207474.1-1566s1c1
Sequence:CCGGGTGTGGATTTAGTTGTGCTTTCTCGAGAAAGCACAACTAAATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-857s1c1
Sequence:CCGGGATACCTAATAAGATGCTGGACTCGAGTCCAGCATCTTATTAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-854s1c1
Sequence:CCGGCCAGATACCTAATAAGATGCTCTCGAGAGCATCTTATTAGGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-861s1c1
Sequence:CCGGCCTAATAAGATGCTGGAATGTCTCGAGACATTCCAGCATCTTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-848s1c1
Sequence:CCGGCCAGATCCAGATACCTAATAACTCGAGTTATTAGGTATCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207474
BCRP2 MISSION shRNA shRNA Plasmid DNA
breakpoint cluster region pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207474.1-1566s1c1
Sequence:CCGGGTGTGGATTTAGTTGTGCTTTCTCGAGAAAGCACAACTAAATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-857s1c1
Sequence:CCGGGATACCTAATAAGATGCTGGACTCGAGTCCAGCATCTTATTAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-854s1c1
Sequence:CCGGCCAGATACCTAATAAGATGCTCTCGAGAGCATCTTATTAGGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-861s1c1
Sequence:CCGGCCTAATAAGATGCTGGAATGTCTCGAGACATTCCAGCATCTTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-848s1c1
Sequence:CCGGCCAGATCCAGATACCTAATAACTCGAGTTATTAGGTATCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207474
BCRP2 MISSION shRNA Lentiviral Transduction Particles
breakpoint cluster region pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207474.1-1566s1c1
Sequence:CCGGGTGTGGATTTAGTTGTGCTTTCTCGAGAAAGCACAACTAAATCCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-857s1c1
Sequence:CCGGGATACCTAATAAGATGCTGGACTCGAGTCCAGCATCTTATTAGGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-854s1c1
Sequence:CCGGCCAGATACCTAATAAGATGCTCTCGAGAGCATCTTATTAGGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-861s1c1
Sequence:CCGGCCTAATAAGATGCTGGAATGTCTCGAGACATTCCAGCATCTTATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207474.1-848s1c1
Sequence:CCGGCCAGATCCAGATACCTAATAACTCGAGTTATTAGGTATCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks