EMAIL THIS PAGE TO A FRIEND

BCS1L

BC1 (ubiquinol-cytochrome c reductase) synthesis-like

67 Gene Product Result for
Synonyms: BCS BCS1 BJS FLNMS GRACILE Hs.6719 MC3DN1 PTD h-BCS
UniProtKB ID: Q9Y276, B3KTW9, Q7Z2V7
Gene ID:
Human(617) Summary: This gene encodes a homolog of the S. cerevisiae bcs1 protein which is involved in the assembly of complex III of the mitochondrial respiratory chain. The encoded protein does not contain a mitochondrial targeting sequence but experimental studies confirm that it is imported into mitochondria. Mutations in this gene are associated with mitochondrial complex III deficiency and the GRACILE syndrome. Five alternatively spliced transcripts encoding the same protein have been described. [provided by RefSeq, Mar 2012]
Mouse(66821) BCS1-like (yeast)
Rat(301514) BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Zebrafish(394157) BCS1-like (yeast)
cow(539713) BCS1-like (S. cerevisiae)
Horse(100055811) BCS1-like (S. cerevisiae)
dog(478911) BCS1-like (S. cerevisiae)
chicken(424212) BCS1-like (S. cerevisiae)
Domestic Rabbit(100351828) BCS1-like (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004328 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079866 Rosetta Predictions human pricing
NM_004328 Rosetta Predictions human pricing
NM_001007666 Rosetta Predictions rat pricing
NM_025784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313980 predicted 619
2 SASI_Hs02_00313981 predicted 483
3 SASI_Hs02_00313982 predicted 654
4 SASI_Hs02_00313983 predicted 401
5 SASI_Hs02_00313984 predicted 483
6 SASI_Hs02_00313985 predicted 378
7 SASI_Hs02_00313986 predicted 738
8 SASI_Hs02_00313987 predicted 389
9 SASI_Hs02_00313988 predicted 302
10 SASI_Hs02_00313989 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191436 predicted 834
2 SASI_Hs01_00191437 predicted 695
3 SASI_Hs02_00337367 predicted 861
4 SASI_Hs02_00337368 predicted 609
5 SASI_Hs02_00337369 predicted 701
6 SASI_Hs01_00191439 predicted 584
7 SASI_Hs01_00191442 predicted 953
8 SASI_Hs02_00337370 predicted 593
9 SASI_Hs02_00337371 predicted 518
10 SASI_Hs02_00337372 predicted 823
11 SASI_Hs01_00191438 predicted 279
12 SASI_Hs01_00191440 predicted 276
13 SASI_Hs01_00191441 predicted 386
14 SASI_Hs01_00191443 predicted 370
15 SASI_Hs01_00191444 predicted 276
16 SASI_Hs01_00191445 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105147 predicted 960
2 SASI_Rn01_00105148 predicted 608
3 SASI_Rn02_00198793 predicted 1334
4 SASI_Rn01_00105149 predicted 604
5 SASI_Rn01_00105150 predicted 917
6 SASI_Rn01_00105151 predicted 1318
7 SASI_Rn01_00105152 predicted 308
8 SASI_Rn01_00105153 predicted 544
9 SASI_Rn01_00105154 predicted 1349
10 SASI_Rn01_00105155 predicted 351
11 SASI_Rn01_00105156 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130457 predicted 439
2 SASI_Mm01_00130458 predicted 504
3 SASI_Mm01_00130459 predicted 1349
4 SASI_Mm01_00130460 predicted 1228
5 SASI_Mm01_00130461 predicted 860
6 SASI_Mm01_00130462 predicted 434
7 SASI_Mm01_00130463 predicted 1336
8 SASI_Mm01_00130464 predicted 208
9 SASI_Mm01_00130465 predicted 1247
10 SASI_Mm01_00130466 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025784
VALIDATED
BCS1L MISSION shRNA Bacterial Glycerol Stock
BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1540s1c1
Sequence:CCGGGCTGTGTTTGTACTTGAGAATCTCGAGATTCTCAAGTACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1237s1c1
Sequence:CCGGCGAGTAGATCTGAAGGAGTATCTCGAGATACTCCTTCAGATCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1389s1c1
Sequence:CCGGGCAAGGCTACTTCATGCTGTACTCGAGTACAGCATGAAGTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-793s1c1
Sequence:CCGGGCTGACCGAATTGTCAAAGATCTCGAGATCTTTGACAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025784.2-443s1c1
Sequence:CCGGCCTCATACCTTCAGCATGAAACTCGAGTTTCATGCTGAAGGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025784.4-1236s21c1
Sequence:CCGGCGAGTAGATCTGAAGGAGTATCTCGAGATACTCCTTCAGATCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025784.4-792s21c1
Sequence:CCGGGCTGACCGAATTGTCAAAGATCTCGAGATCTTTGACAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025784.4-442s21c1
Sequence:CCGGCCTCATACCTTCAGCATGAAACTCGAGTTTCATGCTGAAGGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025784.4-1388s21c1
Sequence:CCGGGCAAGGCTACTTCATGCTGTACTCGAGTACAGCATGAAGTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025784.4-1586s21c1
Sequence:CCGGACAAGATCTACATCTACAAATCTCGAGATTTGTAGATGTAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025784
VALIDATED
BCS1L MISSION shRNA shRNA Plasmid DNA
BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1540s1c1
Sequence:CCGGGCTGTGTTTGTACTTGAGAATCTCGAGATTCTCAAGTACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1237s1c1
Sequence:CCGGCGAGTAGATCTGAAGGAGTATCTCGAGATACTCCTTCAGATCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1389s1c1
Sequence:CCGGGCAAGGCTACTTCATGCTGTACTCGAGTACAGCATGAAGTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-793s1c1
Sequence:CCGGGCTGACCGAATTGTCAAAGATCTCGAGATCTTTGACAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025784.2-443s1c1
Sequence:CCGGCCTCATACCTTCAGCATGAAACTCGAGTTTCATGCTGAAGGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025784.4-1236s21c1
Sequence:CCGGCGAGTAGATCTGAAGGAGTATCTCGAGATACTCCTTCAGATCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025784.4-792s21c1
Sequence:CCGGGCTGACCGAATTGTCAAAGATCTCGAGATCTTTGACAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025784.4-442s21c1
Sequence:CCGGCCTCATACCTTCAGCATGAAACTCGAGTTTCATGCTGAAGGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025784.4-1388s21c1
Sequence:CCGGGCAAGGCTACTTCATGCTGTACTCGAGTACAGCATGAAGTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025784.4-1586s21c1
Sequence:CCGGACAAGATCTACATCTACAAATCTCGAGATTTGTAGATGTAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025784
VALIDATED
BCS1L MISSION shRNA Lentiviral Transduction Particles
BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1540s1c1
Sequence:CCGGGCTGTGTTTGTACTTGAGAATCTCGAGATTCTCAAGTACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1237s1c1
Sequence:CCGGCGAGTAGATCTGAAGGAGTATCTCGAGATACTCCTTCAGATCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-1389s1c1
Sequence:CCGGGCAAGGCTACTTCATGCTGTACTCGAGTACAGCATGAAGTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025784.2-793s1c1
Sequence:CCGGGCTGACCGAATTGTCAAAGATCTCGAGATCTTTGACAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025784.2-443s1c1
Sequence:CCGGCCTCATACCTTCAGCATGAAACTCGAGTTTCATGCTGAAGGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025784.4-1236s21c1
Sequence:CCGGCGAGTAGATCTGAAGGAGTATCTCGAGATACTCCTTCAGATCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025784.4-792s21c1
Sequence:CCGGGCTGACCGAATTGTCAAAGATCTCGAGATCTTTGACAATTCGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025784.4-442s21c1
Sequence:CCGGCCTCATACCTTCAGCATGAAACTCGAGTTTCATGCTGAAGGTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025784.4-1388s21c1
Sequence:CCGGGCAAGGCTACTTCATGCTGTACTCGAGTACAGCATGAAGTAGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294891    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025784.4-1586s21c1
Sequence:CCGGACAAGATCTACATCTACAAATCTCGAGATTTGTAGATGTAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004328
VALIDATED
BCS1L MISSION shRNA Bacterial Glycerol Stock
BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-1419s1c1
Sequence:CCGGCCTTCGAGCTACAAACCAGATCTCGAGATCTGGTTTGTAGCTCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-1396s1c1
Sequence:CCGGGCTGAGAACTTTGCAGAACATCTCGAGATGTTCTGCAAAGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-879s1c1
Sequence:CCGGCGTCCAGGAATTCATCGATAACTCGAGTTATCGATGAATTCCTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004328.3-1159s1c1
Sequence:CCGGCCAGTAAAGTACCAAGGCCTACTCGAGTAGGCCTTGGTACTTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-295s1c1
Sequence:CCGGCTGAAGGACAATCCCTACTTTCTCGAGAAAGTAGGGATTGTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-612s21c1
Sequence:CCGGGCCGCATTTCCACTAAGTTTGCTCGAGCAAACTTAGTGGAAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1498s21c1
Sequence:CCGGCCTTCGAGCTACAAACCAGATCTCGAGATCTGGTTTGTAGCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-699s21c1
Sequence:CCGGGTCGAGAGATGCAGATGATAGCTCGAGCTATCATCTGCATCTCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1475s21c1
Sequence:CCGGGCTGAGAACTTTGCAGAACATCTCGAGATGTTCTGCAAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1013s21c1
Sequence:CCGGAGACGTGGCTACCTGCTTTATCTCGAGATAAAGCAGGTAGCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004328
VALIDATED
BCS1L MISSION shRNA shRNA Plasmid DNA
BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-1419s1c1
Sequence:CCGGCCTTCGAGCTACAAACCAGATCTCGAGATCTGGTTTGTAGCTCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-1396s1c1
Sequence:CCGGGCTGAGAACTTTGCAGAACATCTCGAGATGTTCTGCAAAGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-879s1c1
Sequence:CCGGCGTCCAGGAATTCATCGATAACTCGAGTTATCGATGAATTCCTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004328.3-1159s1c1
Sequence:CCGGCCAGTAAAGTACCAAGGCCTACTCGAGTAGGCCTTGGTACTTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-295s1c1
Sequence:CCGGCTGAAGGACAATCCCTACTTTCTCGAGAAAGTAGGGATTGTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-612s21c1
Sequence:CCGGGCCGCATTTCCACTAAGTTTGCTCGAGCAAACTTAGTGGAAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1498s21c1
Sequence:CCGGCCTTCGAGCTACAAACCAGATCTCGAGATCTGGTTTGTAGCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-699s21c1
Sequence:CCGGGTCGAGAGATGCAGATGATAGCTCGAGCTATCATCTGCATCTCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1475s21c1
Sequence:CCGGGCTGAGAACTTTGCAGAACATCTCGAGATGTTCTGCAAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1013s21c1
Sequence:CCGGAGACGTGGCTACCTGCTTTATCTCGAGATAAAGCAGGTAGCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004328
VALIDATED
BCS1L MISSION shRNA Lentiviral Transduction Particles
BC1 (ubiquinol-cytochrome c reductase) synthesis-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-1419s1c1
Sequence:CCGGCCTTCGAGCTACAAACCAGATCTCGAGATCTGGTTTGTAGCTCGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-1396s1c1
Sequence:CCGGGCTGAGAACTTTGCAGAACATCTCGAGATGTTCTGCAAAGTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-879s1c1
Sequence:CCGGCGTCCAGGAATTCATCGATAACTCGAGTTATCGATGAATTCCTGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004328.3-1159s1c1
Sequence:CCGGCCAGTAAAGTACCAAGGCCTACTCGAGTAGGCCTTGGTACTTTACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_004328.3-295s1c1
Sequence:CCGGCTGAAGGACAATCCCTACTTTCTCGAGAAAGTAGGGATTGTCCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-612s21c1
Sequence:CCGGGCCGCATTTCCACTAAGTTTGCTCGAGCAAACTTAGTGGAAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1498s21c1
Sequence:CCGGCCTTCGAGCTACAAACCAGATCTCGAGATCTGGTTTGTAGCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-699s21c1
Sequence:CCGGGTCGAGAGATGCAGATGATAGCTCGAGCTATCATCTGCATCTCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1475s21c1
Sequence:CCGGGCTGAGAACTTTGCAGAACATCTCGAGATGTTCTGCAAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004328.4-1013s21c1
Sequence:CCGGAGACGTGGCTACCTGCTTTATCTCGAGATAAAGCAGGTAGCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks