EMAIL THIS PAGE TO A FRIEND

BDH1

3-hydroxybutyrate dehydrogenase, type 1

174 Gene Product Result for
Synonyms: BDH SDR9C1
UniProtKB ID: Q02338, D3DXC0, Q96ET1, Q9BRZ4
Gene ID:
Human(622) Summary: This gene encodes a member of the short-chain dehydrogenase/reductase gene family. The encoded protein forms a homotetrameric lipid-requiring enzyme of the mitochondrial membrane and has a specific requirement for phosphatidylcholine for optimal enzymatic activity. The encoded protein catalyzes the interconversion of acetoacetate and (R)-3-hydroxybutyrate, the two major ketone bodies produced during fatty acid catabolism. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(71911) 3-hydroxybutyrate dehydrogenase, type 1
Rat(117099) 3-hydroxybutyrate dehydrogenase, type 1
Zebrafish(100037356) 3-hydroxybutyrate dehydrogenase, type 1
cow(534090) 3-hydroxybutyrate dehydrogenase, type 1
domestic cat(101084982) 3-hydroxybutyrate dehydrogenase, type 1
dog(488037) 3-hydroxybutyrate dehydrogenase, type 1
chicken(424891) 3-hydroxybutyrate dehydrogenase, type 1
sheep(101104112) 3-hydroxybutyrate dehydrogenase, type 1
domestic guinea pig(100735965) 3-hydroxybutyrate dehydrogenase, type 1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203315 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004051 Rosetta Predictions human pricing
NM_203314 Rosetta Predictions human pricing
NM_203315 Rosetta Predictions human pricing
NM_053995 Rosetta Predictions rat pricing
NM_001122683 Rosetta Predictions mouse pricing
NM_175177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208303 predicted 1659
2 SASI_Hs01_00208304 predicted 1530
3 SASI_Hs01_00208305 predicted 997
4 SASI_Hs01_00208306 predicted 1338
5 SASI_Hs01_00208307 predicted 1519
6 SASI_Hs02_00336821 predicted 1523
7 SASI_Hs01_00208308 predicted 723
8 SASI_Hs02_00336822 predicted 1064
9 SASI_Hs01_00208310 predicted 1491
10 SASI_Hs01_00208311 predicted 550
11 SASI_Hs01_00208309 predicted 1264
12 SASI_Hs01_00208312 predicted 1646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043530 predicted 1809
2 SASI_Hs01_00043531 predicted 1677
3 SASI_Hs01_00043532 predicted 1151
4 SASI_Hs01_00043533 predicted 1491
5 SASI_Hs01_00043534 predicted 1671
6 SASI_Hs02_00373249 predicted 1667
7 SASI_Hs01_00043535 predicted 875
8 SASI_Hs02_00373250 predicted 1210
9 SASI_Hs01_00043537 predicted 1639
10 SASI_Hs01_00043538 predicted 703
11 SASI_Hs01_00043536 predicted 1416
12 SASI_Hs01_00043539 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019262 predicted 1589
2 SASI_Hs01_00019263 predicted 1464
3 SASI_Hs01_00019264 predicted 935
4 SASI_Hs01_00019265 predicted 1274
5 SASI_Hs01_00019266 predicted 1452
6 SASI_Hs02_00373251 predicted 1451
7 SASI_Hs01_00019267 predicted 662
8 SASI_Hs02_00373252 predicted 999
9 SASI_Hs01_00019269 predicted 1423
10 SASI_Hs01_00019270 predicted 486
11 SASI_Hs01_00019268 predicted 1201
12 SASI_Hs01_00019271 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266991 predicted 960
2 SASI_Rn01_00057871 predicted 1324
3 SASI_Rn01_00057874 predicted 285
4 SASI_Rn01_00057875 predicted 938
5 SASI_Rn01_00057876 predicted 591
6 SASI_Rn01_00057877 predicted 1016
7 SASI_Rn01_00057878 predicted 1209
8 SASI_Rn01_00057879 predicted 521
9 SASI_Rn02_00266992 predicted 440
10 SASI_Rn01_00057880 predicted 681
11 SASI_Rn01_00057872 predicted 254
12 SASI_Rn01_00057873 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309234 predicted 753
2 SASI_Mm02_00309235 predicted 893
3 SASI_Mm02_00309236 predicted 782
4 SASI_Mm02_00309237 predicted 738
5 SASI_Mm02_00309238 predicted 1150
6 SASI_Mm02_00309239 predicted 1138
7 SASI_Mm02_00309240 predicted 600
8 SASI_Mm02_00309241 predicted 670
9 SASI_Mm02_00309242 predicted 1138
10 SASI_Mm02_00309243 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345819 predicted 733
2 SASI_Mm01_00162531 predicted 866
3 SASI_Mm01_00162528 predicted 765
4 SASI_Mm01_00162529 predicted 719
5 SASI_Mm01_00162530 predicted 1133
6 SASI_Mm01_00162532 predicted 1119
7 SASI_Mm01_00162533 predicted 589
8 SASI_Mm01_00162534 predicted 650
9 SASI_Mm02_00345820 predicted 1112
10 SASI_Mm01_00162536 predicted 544
11 SASI_Mm01_00162527 predicted 433
12 SASI_Mm01_00162535 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203315
VALIDATED
BDH1 MISSION shRNA Bacterial Glycerol Stock
3-hydroxybutyrate dehydrogenase, type 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-272s21c1
Sequence:CCGGGCCCACTATTGCTTGGTTCTACTCGAGTAGAACCAAGCAATAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203315.2-1707s21c1
Sequence:CCGGGGATCCATTTGCCCGAGAATCCTCGAGGATTCTCGGGCAAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-998s21c1
Sequence:CCGGACTACGGCAAGAAGTACTTTGCTCGAGCAAAGTACTTCTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-282s21c1
Sequence:CCGGGCTTGGTTCTACTTCCTTTATCTCGAGATAAAGGAAGTAGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-440s21c1
Sequence:CCGGGCTGCTTGATGAAGGACAAAGCTCGAGCTTTGTCCTTCATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-272s1c1
Sequence:CCGGGCCCACTATTGCTTGGTTCTACTCGAGTAGAACCAAGCAATAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-1004s1c1
Sequence:CCGGGCAAGAAGTACTTTGATGAAACTCGAGTTTCATCAAAGTACTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203315.1-486s1c1
Sequence:CCGGCAGCCTAAACAGTGACCGATTCTCGAGAATCGGTCACTGTTTAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203315.1-753s1c1
Sequence:CCGGCGTCGTCAATATCAGCAGCATCTCGAGATGCTGCTGATATTGACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-282s1c1
Sequence:CCGGGCTTGGTTCTACTTCCTTTATCTCGAGATAAAGGAAGTAGAACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203315
VALIDATED
BDH1 MISSION shRNA shRNA Plasmid DNA
3-hydroxybutyrate dehydrogenase, type 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-272s21c1
Sequence:CCGGGCCCACTATTGCTTGGTTCTACTCGAGTAGAACCAAGCAATAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203315.2-1707s21c1
Sequence:CCGGGGATCCATTTGCCCGAGAATCCTCGAGGATTCTCGGGCAAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-998s21c1
Sequence:CCGGACTACGGCAAGAAGTACTTTGCTCGAGCAAAGTACTTCTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-282s21c1
Sequence:CCGGGCTTGGTTCTACTTCCTTTATCTCGAGATAAAGGAAGTAGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-440s21c1
Sequence:CCGGGCTGCTTGATGAAGGACAAAGCTCGAGCTTTGTCCTTCATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-272s1c1
Sequence:CCGGGCCCACTATTGCTTGGTTCTACTCGAGTAGAACCAAGCAATAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-1004s1c1
Sequence:CCGGGCAAGAAGTACTTTGATGAAACTCGAGTTTCATCAAAGTACTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203315.1-486s1c1
Sequence:CCGGCAGCCTAAACAGTGACCGATTCTCGAGAATCGGTCACTGTTTAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203315.1-753s1c1
Sequence:CCGGCGTCGTCAATATCAGCAGCATCTCGAGATGCTGCTGATATTGACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-282s1c1
Sequence:CCGGGCTTGGTTCTACTTCCTTTATCTCGAGATAAAGGAAGTAGAACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203315
VALIDATED
BDH1 MISSION shRNA Lentiviral Transduction Particles
3-hydroxybutyrate dehydrogenase, type 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-272s21c1
Sequence:CCGGGCCCACTATTGCTTGGTTCTACTCGAGTAGAACCAAGCAATAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203315.2-1707s21c1
Sequence:CCGGGGATCCATTTGCCCGAGAATCCTCGAGGATTCTCGGGCAAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-998s21c1
Sequence:CCGGACTACGGCAAGAAGTACTTTGCTCGAGCAAAGTACTTCTTGCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-282s21c1
Sequence:CCGGGCTTGGTTCTACTTCCTTTATCTCGAGATAAAGGAAGTAGAACCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_203315.2-440s21c1
Sequence:CCGGGCTGCTTGATGAAGGACAAAGCTCGAGCTTTGTCCTTCATCAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-272s1c1
Sequence:CCGGGCCCACTATTGCTTGGTTCTACTCGAGTAGAACCAAGCAATAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-1004s1c1
Sequence:CCGGGCAAGAAGTACTTTGATGAAACTCGAGTTTCATCAAAGTACTTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203315.1-486s1c1
Sequence:CCGGCAGCCTAAACAGTGACCGATTCTCGAGAATCGGTCACTGTTTAGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203315.1-753s1c1
Sequence:CCGGCGTCGTCAATATCAGCAGCATCTCGAGATGCTGCTGATATTGACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_203315.1-282s1c1
Sequence:CCGGGCTTGGTTCTACTTCCTTTATCTCGAGATAAAGGAAGTAGAACCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175177
VALIDATED
BDH1 MISSION shRNA Bacterial Glycerol Stock
3-hydroxybutyrate dehydrogenase, type 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175177.3-829s1c1
Sequence:CCGGCGTCGTTAACATCAGCAGCATCTCGAGATGCTGCTGATGTTAACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1080s1c1
Sequence:CCGGGCAGGAAGTACTTCGATGAAACTCGAGTTTCATCGAAGTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1102s1c1
Sequence:CCGGGATTGCCAAGATGGAAACCTACTCGAGTAGGTTTCCATCTTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-340s1c1
Sequence:CCGGGACAAGACACACGCTGTTGTTCTCGAGAACAACAGCGTGTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1237s1c1
Sequence:CCGGGATGCAGATCATGACCCATTTCTCGAGAAATGGGTCATGATCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175177
VALIDATED
BDH1 MISSION shRNA shRNA Plasmid DNA
3-hydroxybutyrate dehydrogenase, type 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175177.3-829s1c1
Sequence:CCGGCGTCGTTAACATCAGCAGCATCTCGAGATGCTGCTGATGTTAACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1080s1c1
Sequence:CCGGGCAGGAAGTACTTCGATGAAACTCGAGTTTCATCGAAGTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1102s1c1
Sequence:CCGGGATTGCCAAGATGGAAACCTACTCGAGTAGGTTTCCATCTTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-340s1c1
Sequence:CCGGGACAAGACACACGCTGTTGTTCTCGAGAACAACAGCGTGTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1237s1c1
Sequence:CCGGGATGCAGATCATGACCCATTTCTCGAGAAATGGGTCATGATCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175177
VALIDATED
BDH1 MISSION shRNA Lentiviral Transduction Particles
3-hydroxybutyrate dehydrogenase, type 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175177.3-829s1c1
Sequence:CCGGCGTCGTTAACATCAGCAGCATCTCGAGATGCTGCTGATGTTAACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1080s1c1
Sequence:CCGGGCAGGAAGTACTTCGATGAAACTCGAGTTTCATCGAAGTACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1102s1c1
Sequence:CCGGGATTGCCAAGATGGAAACCTACTCGAGTAGGTTTCCATCTTGGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-340s1c1
Sequence:CCGGGACAAGACACACGCTGTTGTTCTCGAGAACAACAGCGTGTGTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_175177.3-1237s1c1
Sequence:CCGGGATGCAGATCATGACCCATTTCTCGAGAAATGGGTCATGATCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks