EMAIL THIS PAGE TO A FRIEND

BDH2

3-hydroxybutyrate dehydrogenase, type 2

66 Gene Product Result for
Synonyms: DHRS6 EFA6R PRO20933 SDR15C1 UCPA-OR UNQ6308
Gene ID:
Mouse(69772) 3-hydroxybutyrate dehydrogenase, type 2
Rat(295458) 3-hydroxybutyrate dehydrogenase, type 2
domestic guinea pig(100717546) 3-hydroxybutyrate dehydrogenase, type 2
naked mole-rat(101723446) 3-hydroxybutyrate dehydrogenase, type 2
sheep(101106011) 3-hydroxybutyrate dehydrogenase, type 2
Zebrafish(550507) 3-hydroxybutyrate dehydrogenase, type 2
chicken(422715) 3-hydroxybutyrate dehydrogenase, type 2
cow(515321) 3-hydroxybutyrate dehydrogenase, type 2
domestic cat(101094095) 3-hydroxybutyrate dehydrogenase, type 2
dog(478497) 3-hydroxybutyrate dehydrogenase, type 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027208 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027208 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027208 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020139 Rosetta Predictions human pricing
NM_001106473 Rosetta Predictions rat pricing
NM_027208 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201227 predicted 201
2 SASI_Hs01_00201228 predicted 422
3 SASI_Hs01_00201231 predicted 474
4 SASI_Hs02_00353019 predicted 290
5 SASI_Hs01_00201232 predicted 780
6 SASI_Hs02_00353020 predicted 763
7 SASI_Hs01_00201234 predicted 787
8 SASI_Hs02_00353021 predicted 636
9 SASI_Hs02_00353022 predicted 772
10 SASI_Hs02_00353023 predicted 288
11 SASI_Hs01_00201229 predicted 390
12 SASI_Hs01_00201230 predicted 805
13 SASI_Hs01_00201233 predicted 465
14 SASI_Hs01_00201235 predicted 367
15 SASI_Hs01_00201236 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106473 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219308 predicted 433
2 SASI_Rn02_00219309 predicted 542
3 SASI_Rn02_00219310 predicted 882
4 SASI_Rn02_00219311 predicted 508
5 SASI_Rn02_00219312 predicted 816
6 SASI_Rn02_00219313 predicted 304
7 SASI_Rn02_00219314 predicted 318
8 SASI_Rn02_00219315 predicted 474
9 SASI_Rn02_00219316 predicted 644
10 SASI_Rn02_00219317 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106162 predicted 357
2 SASI_Mm01_00106163 predicted 459
3 SASI_Mm01_00106164 predicted 407
4 SASI_Mm01_00106165 predicted 767
5 SASI_Mm01_00106166 predicted 468
6 SASI_Mm01_00106167 predicted 287
7 SASI_Mm01_00106168 predicted 791
8 SASI_Mm01_00106169 predicted 593
9 SASI_Mm01_00106171 predicted 223
10 SASI_Mm02_00331752 predicted 780
11 SASI_Mm01_00106170 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027208
VALIDATED
BDH2 MISSION shRNA Bacterial Glycerol Stock
3-hydroxybutyrate dehydrogenase, type 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-231s1c1
Sequence:CCGGGCTGGAAAGTTACCGAGGTATCTCGAGATACCTCGGTAACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-188s1c1
Sequence:CCGGCCAAAGTCATAGCCACAGATACTCGAGTATCTGTGGCTATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-312s1c1
Sequence:CCGGCGAGAGAATTGATGTTCTCTTCTCGAGAAGAGAACATCAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-643s1c1
Sequence:CCGGCCATCTCTGCAAGAAAGAATACTCGAGTATTCTTTCTTGCAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-773s1c1
Sequence:CCGGCGGACGAGTCAGCCTATGTAACTCGAGTTACATAGGCTGACTCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027208
VALIDATED
BDH2 MISSION shRNA shRNA Plasmid DNA
3-hydroxybutyrate dehydrogenase, type 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-231s1c1
Sequence:CCGGGCTGGAAAGTTACCGAGGTATCTCGAGATACCTCGGTAACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-188s1c1
Sequence:CCGGCCAAAGTCATAGCCACAGATACTCGAGTATCTGTGGCTATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-312s1c1
Sequence:CCGGCGAGAGAATTGATGTTCTCTTCTCGAGAAGAGAACATCAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-643s1c1
Sequence:CCGGCCATCTCTGCAAGAAAGAATACTCGAGTATTCTTTCTTGCAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-773s1c1
Sequence:CCGGCGGACGAGTCAGCCTATGTAACTCGAGTTACATAGGCTGACTCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027208
VALIDATED
BDH2 MISSION shRNA Lentiviral Transduction Particles
3-hydroxybutyrate dehydrogenase, type 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-231s1c1
Sequence:CCGGGCTGGAAAGTTACCGAGGTATCTCGAGATACCTCGGTAACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-188s1c1
Sequence:CCGGCCAAAGTCATAGCCACAGATACTCGAGTATCTGTGGCTATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-312s1c1
Sequence:CCGGCGAGAGAATTGATGTTCTCTTCTCGAGAAGAGAACATCAATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-643s1c1
Sequence:CCGGCCATCTCTGCAAGAAAGAATACTCGAGTATTCTTTCTTGCAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027208.1-773s1c1
Sequence:CCGGCGGACGAGTCAGCCTATGTAACTCGAGTTACATAGGCTGACTCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020139
VALIDATED
BDH2 MISSION shRNA Bacterial Glycerol Stock
3-hydroxybutyrate dehydrogenase, type 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-643s1c1
Sequence:CCGGCGCCATCTCTACAAGAAAGAACTCGAGTTCTTTCTTGTAGAGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020139.2-190s1c1
Sequence:CCGGCCAAAGTCATAGCCACAGACACTCGAGTGTCTGTGGCTATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-387s1c1
Sequence:CCGGGACTGGGACTTCTCGATGAATCTCGAGATTCATCGAGAAGTCCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-462s1c1
Sequence:CCGGGCTCAGAAATCTGGCAATATTCTCGAGAATATTGCCAGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-303s1c1
Sequence:CCGGGCCAGTGAAGTTGAGAGACTTCTCGAGAAGTCTCTCAACTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-203s21c1
Sequence:CCGGTCATAGCCACAGACATTAATGCTCGAGCATTAATGTCTGTGGCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020139.3-755s21c1
Sequence:CCGGTAGCCATGCTCTGCGTGTATTCTCGAGAATACACGCAGAGCATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020139.3-2000s21c1
Sequence:CCGGACGGATGCCATCCCTTATTATCTCGAGATAATAAGGGATGGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-395s21c1
Sequence:CCGGACTGGGACTTCTCGATGAATCCTCGAGGATTCATCGAGAAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-325s21c1
Sequence:CCGGAGACTTGATGTTCTCTTTAATCTCGAGATTAAAGAGAACATCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020139
VALIDATED
BDH2 MISSION shRNA shRNA Plasmid DNA
3-hydroxybutyrate dehydrogenase, type 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-643s1c1
Sequence:CCGGCGCCATCTCTACAAGAAAGAACTCGAGTTCTTTCTTGTAGAGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020139.2-190s1c1
Sequence:CCGGCCAAAGTCATAGCCACAGACACTCGAGTGTCTGTGGCTATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-387s1c1
Sequence:CCGGGACTGGGACTTCTCGATGAATCTCGAGATTCATCGAGAAGTCCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-462s1c1
Sequence:CCGGGCTCAGAAATCTGGCAATATTCTCGAGAATATTGCCAGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-303s1c1
Sequence:CCGGGCCAGTGAAGTTGAGAGACTTCTCGAGAAGTCTCTCAACTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-203s21c1
Sequence:CCGGTCATAGCCACAGACATTAATGCTCGAGCATTAATGTCTGTGGCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020139.3-755s21c1
Sequence:CCGGTAGCCATGCTCTGCGTGTATTCTCGAGAATACACGCAGAGCATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020139.3-2000s21c1
Sequence:CCGGACGGATGCCATCCCTTATTATCTCGAGATAATAAGGGATGGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-395s21c1
Sequence:CCGGACTGGGACTTCTCGATGAATCCTCGAGGATTCATCGAGAAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-325s21c1
Sequence:CCGGAGACTTGATGTTCTCTTTAATCTCGAGATTAAAGAGAACATCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020139
VALIDATED
BDH2 MISSION shRNA Lentiviral Transduction Particles
3-hydroxybutyrate dehydrogenase, type 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-643s1c1
Sequence:CCGGCGCCATCTCTACAAGAAAGAACTCGAGTTCTTTCTTGTAGAGATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020139.2-190s1c1
Sequence:CCGGCCAAAGTCATAGCCACAGACACTCGAGTGTCTGTGGCTATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-387s1c1
Sequence:CCGGGACTGGGACTTCTCGATGAATCTCGAGATTCATCGAGAAGTCCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-462s1c1
Sequence:CCGGGCTCAGAAATCTGGCAATATTCTCGAGAATATTGCCAGATTTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_020139.2-303s1c1
Sequence:CCGGGCCAGTGAAGTTGAGAGACTTCTCGAGAAGTCTCTCAACTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-203s21c1
Sequence:CCGGTCATAGCCACAGACATTAATGCTCGAGCATTAATGTCTGTGGCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020139.3-755s21c1
Sequence:CCGGTAGCCATGCTCTGCGTGTATTCTCGAGAATACACGCAGAGCATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244983    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020139.3-2000s21c1
Sequence:CCGGACGGATGCCATCCCTTATTATCTCGAGATAATAAGGGATGGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-395s21c1
Sequence:CCGGACTGGGACTTCTCGATGAATCCTCGAGGATTCATCGAGAAGTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020139.3-325s21c1
Sequence:CCGGAGACTTGATGTTCTCTTTAATCTCGAGATTAAAGAGAACATCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks