EMAIL THIS PAGE TO A FRIEND

BDKRB1

bradykinin receptor B1

56 Gene Product Result for
Synonyms: B1BKR B1R BKB1R BKR1 BRADYB1
UniProtKB ID: P46663, A8K7F5, Q546S7, Q8N0Y8
Gene ID:
Human(623) Summary: Bradykinin, a 9 aa peptide, is generated in pathophysiologic conditions such as inflammation, trauma, burns, shock, and allergy. Two types of G-protein coupled receptors have been found which bind bradykinin and mediate responses to these pathophysiologic conditions. The protein encoded by this gene is one of these receptors and is synthesized de novo following tissue injury. Receptor binding leads to an increase in the cytosolic calcium ion concentration, ultimately resulting in chronic and acute inflammatory responses. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(12061) bradykinin receptor, beta 1
Rat(81509) bradykinin receptor B1
Zebrafish(368199) bradykinin receptor B1
dog(490847) bradykinin receptor B1
cow(532119) bradykinin receptor B1
domestic cat(101090700) bradykinin receptor B1
chicken(772372) bradykinin receptor B1
Domestic Rabbit(100009198) bradykinin receptor B1
naked mole-rat(101724010) bradykinin receptor B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
B6929 Lys-(des-Arg9, Leu8)-Bradykinin trifluoroacetate salt ≥95% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007539 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007539 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007539 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000710 Rosetta Predictions human pricing
NM_030851 Rosetta Predictions rat pricing
NM_007539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012974 predicted 448
2 SASI_Hs01_00012975 predicted 486
3 SASI_Hs01_00012976 predicted 559
4 SASI_Hs01_00012977 predicted 801
5 SASI_Hs01_00012978 predicted 548
6 SASI_Hs01_00012979 predicted 559
7 SASI_Hs02_00303118 predicted 406
8 SASI_Hs01_00012980 predicted 487
9 SASI_Hs01_00012981 predicted 405
10 SASI_Hs01_00012982 predicted 1000
11 SASI_Hs01_00012983 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109006 predicted 362
2 SASI_Rn01_00109007 predicted 508
3 SASI_Rn01_00109008 predicted 685
4 SASI_Rn01_00109009 predicted 391
5 SASI_Rn01_00109010 predicted 252
6 SASI_Rn01_00109011 predicted 983
7 SASI_Rn01_00109012 predicted 672
8 SASI_Rn01_00109013 predicted 767
9 SASI_Rn01_00109014 predicted 570
10 SASI_Rn02_00264094 predicted 812
11 SASI_Rn01_00109015 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195657 predicted 300
2 SASI_Mm01_00195658 predicted 1090
3 SASI_Mm01_00195659 predicted 1039
4 SASI_Mm02_00311877 predicted 630
5 SASI_Mm01_00195660 predicted 495
6 SASI_Mm01_00195661 predicted 205
7 SASI_Mm01_00195662 predicted 449
8 SASI_Mm01_00195663 predicted 1071
9 SASI_Mm01_00195665 predicted 935
10 SASI_Mm01_00195666 predicted 509
11 SASI_Mm01_00195664 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007539
BDKRB1 MISSION shRNA Bacterial Glycerol Stock
bradykinin receptor B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-423s1c1
Sequence:CCGGCCGCTACAGGTTGCTGGTATACTCGAGTATACCAGCAACCTGTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-670s1c1
Sequence:CCGGGCCATCCTCTACTTCAACTTTCTCGAGAAAGTTGAAGTAGAGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-222s1c1
Sequence:CCGGGCGCCTAACCATAGCAGAAATCTCGAGATTTCTGCTATGGTTAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-675s1c1
Sequence:CCGGCCTCTACTTCAACTTTCACATCTCGAGATGTGAAAGTTGAAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-259s1c1
Sequence:CCGGGCAGCTTCTGATCTGGTGTTTCTCGAGAAACACCAGATCAGAAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007539
BDKRB1 MISSION shRNA shRNA Plasmid DNA
bradykinin receptor B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-423s1c1
Sequence:CCGGCCGCTACAGGTTGCTGGTATACTCGAGTATACCAGCAACCTGTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-670s1c1
Sequence:CCGGGCCATCCTCTACTTCAACTTTCTCGAGAAAGTTGAAGTAGAGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-222s1c1
Sequence:CCGGGCGCCTAACCATAGCAGAAATCTCGAGATTTCTGCTATGGTTAGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-675s1c1
Sequence:CCGGCCTCTACTTCAACTTTCACATCTCGAGATGTGAAAGTTGAAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-259s1c1
Sequence:CCGGGCAGCTTCTGATCTGGTGTTTCTCGAGAAACACCAGATCAGAAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007539
BDKRB1 MISSION shRNA Lentiviral Transduction Particles
bradykinin receptor B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-423s1c1
Sequence:CCGGCCGCTACAGGTTGCTGGTATACTCGAGTATACCAGCAACCTGTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-670s1c1
Sequence:CCGGGCCATCCTCTACTTCAACTTTCTCGAGAAAGTTGAAGTAGAGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-222s1c1
Sequence:CCGGGCGCCTAACCATAGCAGAAATCTCGAGATTTCTGCTATGGTTAGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-675s1c1
Sequence:CCGGCCTCTACTTCAACTTTCACATCTCGAGATGTGAAAGTTGAAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007539.1-259s1c1
Sequence:CCGGGCAGCTTCTGATCTGGTGTTTCTCGAGAAACACCAGATCAGAAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000710
BDKRB1 MISSION shRNA Bacterial Glycerol Stock
bradykinin receptor B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-1122s1c1
Sequence:CCGGGCTCCCTGAATCCAGTAATTTCTCGAGAAATTACTGGATTCAGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-809s1c1
Sequence:CCGGGCAAGGATTGTGGAGTTAAATCTCGAGATTTAACTCCACAATCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-1000s1c1
Sequence:CCGGCCCTTACCACTTCTTTGCCTTCTCGAGAAGGCAAAGAAGTGGTAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-491s1c1
Sequence:CCGGGAGAATATCTGGAACCAGTTTCTCGAGAAACTGGTTCCAGATATTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-328s1c1
Sequence:CCGGGCCAACATTTATCATCTCCATCTCGAGATGGAGATGATAAATGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-810s21c1
Sequence:CCGGCAAGGATTGTGGAGTTAAATACTCGAGTATTTAACTCCACAATCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-492s21c1
Sequence:CCGGAGAATATCTGGAACCAGTTTACTCGAGTAAACTGGTTCCAGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-1121s21c1
Sequence:CCGGAGCTCCCTGAATCCAGTAATTCTCGAGAATTACTGGATTCAGGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000710
BDKRB1 MISSION shRNA shRNA Plasmid DNA
bradykinin receptor B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-1122s1c1
Sequence:CCGGGCTCCCTGAATCCAGTAATTTCTCGAGAAATTACTGGATTCAGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-809s1c1
Sequence:CCGGGCAAGGATTGTGGAGTTAAATCTCGAGATTTAACTCCACAATCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-1000s1c1
Sequence:CCGGCCCTTACCACTTCTTTGCCTTCTCGAGAAGGCAAAGAAGTGGTAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-491s1c1
Sequence:CCGGGAGAATATCTGGAACCAGTTTCTCGAGAAACTGGTTCCAGATATTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-328s1c1
Sequence:CCGGGCCAACATTTATCATCTCCATCTCGAGATGGAGATGATAAATGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-810s21c1
Sequence:CCGGCAAGGATTGTGGAGTTAAATACTCGAGTATTTAACTCCACAATCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-492s21c1
Sequence:CCGGAGAATATCTGGAACCAGTTTACTCGAGTAAACTGGTTCCAGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-1121s21c1
Sequence:CCGGAGCTCCCTGAATCCAGTAATTCTCGAGAATTACTGGATTCAGGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000710
BDKRB1 MISSION shRNA Lentiviral Transduction Particles
bradykinin receptor B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-1122s1c1
Sequence:CCGGGCTCCCTGAATCCAGTAATTTCTCGAGAAATTACTGGATTCAGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-809s1c1
Sequence:CCGGGCAAGGATTGTGGAGTTAAATCTCGAGATTTAACTCCACAATCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-1000s1c1
Sequence:CCGGCCCTTACCACTTCTTTGCCTTCTCGAGAAGGCAAAGAAGTGGTAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-491s1c1
Sequence:CCGGGAGAATATCTGGAACCAGTTTCTCGAGAAACTGGTTCCAGATATTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000710.2-328s1c1
Sequence:CCGGGCCAACATTTATCATCTCCATCTCGAGATGGAGATGATAAATGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-810s21c1
Sequence:CCGGCAAGGATTGTGGAGTTAAATACTCGAGTATTTAACTCCACAATCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-492s21c1
Sequence:CCGGAGAATATCTGGAACCAGTTTACTCGAGTAAACTGGTTCCAGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000710.2-1121s21c1
Sequence:CCGGAGCTCCCTGAATCCAGTAATTCTCGAGAATTACTGGATTCAGGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)