EMAIL THIS PAGE TO A FRIEND

BDKRB2

bradykinin receptor B2

70 Gene Product Result for
Synonyms: B2R BK-2 BK2 BKR2 BRB2
UniProtKB ID: P30411
Gene ID:
Human(624) Summary: This gene encodes a receptor for bradykinin. The 9 aa bradykinin peptide elicits many responses including vasodilation, edema, smooth muscle spasm and pain fiber stimulation. This receptor associates with G proteins that stimulate a phosphatidylinositol-calcium second messenger system. Alternate start codons result in two isoforms of the protein. [provided by RefSeq, Jul 2008]
Mouse(12062) bradykinin receptor, beta 2
Rat(25245) bradykinin receptor B2
domestic guinea pig(100135486) bradykinin receptor, beta 2
naked mole-rat(101723648) bradykinin receptor B2
sheep(101120781) bradykinin receptor B2
Domestic Rabbit(100328963) bradykinin receptor B2
chicken(428906) bradykinin receptor B2
cow(538896) bradykinin receptor B2
domestic cat(101082667) bradykinin receptor B2
dog(403658) bradykinin receptor B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
H157 HOE 140 ≥94% human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000623 Rosetta Predictions human pricing
NM_173100 Rosetta Predictions rat pricing
NM_009747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174697 predicted 1386
2 SASI_Hs02_00302957 predicted 1782
3 SASI_Hs01_00174698 predicted 1596
4 SASI_Hs02_00302958 predicted 1475
5 SASI_Hs02_00302959 predicted 308
6 SASI_Hs02_00302960 predicted 1453
7 SASI_Hs01_00174701 predicted 596
8 SASI_Hs01_00174702 predicted 1408
9 SASI_Hs01_00174704 predicted 1119
10 SASI_Hs02_00302961 predicted 207
11 SASI_Hs01_00174696 predicted 356
12 SASI_Hs01_00174699 predicted 742
13 SASI_Hs01_00174700 predicted 1636
14 SASI_Hs01_00174703 predicted 235
15 SASI_Hs01_00174705 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031831 predicted 439
2 SASI_Rn01_00031832 predicted 367
3 SASI_Rn01_00031833 predicted 1058
4 SASI_Rn01_00031834 predicted 1050
5 SASI_Rn01_00031835 predicted 568
6 SASI_Rn01_00031836 predicted 1103
7 SASI_Rn02_00269254 predicted 1199
8 SASI_Rn01_00031837 predicted 458
9 SASI_Rn01_00031838 predicted 263
10 SASI_Rn01_00031839 predicted 854
11 SASI_Rn01_00031840 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173036 predicted 430
2 SASI_Mm01_00173037 predicted 715
3 SASI_Mm01_00173038 predicted 263
4 SASI_Mm01_00173039 predicted 265
5 SASI_Mm01_00173040 predicted 1229
6 SASI_Mm01_00173041 predicted 200
7 SASI_Mm01_00173043 predicted 381
8 SASI_Mm01_00173044 predicted 567
9 SASI_Mm01_00173045 predicted 1082
10 SASI_Mm02_00316933 predicted 415
11 SASI_Mm01_00173042 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009747
BDKRB2 MISSION shRNA Bacterial Glycerol Stock
bradykinin receptor B2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009747.2-265s21c1
Sequence:CCGGAGTGGTGGAGTTGGCTCAATGCTCGAGCATTGAGCCAACTCCACCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009747.2-1483s21c1
Sequence:CCGGTACTGACTGACGCTCTAATTCCTCGAGGAATTAGAGCGTCAGTCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009747.2-860s21c1
Sequence:CCGGGGTGCTGAGGAACAACGAGATCTCGAGATCTCGTTGTTCCTCAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009747.2-1420s1c1
Sequence:CCGGCCTGTCTCATGGCATAAGCATCTCGAGATGCTTATGCCATGAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-351s1c1
Sequence:CCGGAGCGTGTTCTTCCTGCACAAACTCGAGTTTGTGCAGGAAGAACACGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-518s1c1
Sequence:CCGGCATGATCTACATGAACCTGTACTCGAGTACAGGTTCATGTAGATCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-1049s1c1
Sequence:CCGGCATCACGCAGATCAGTTCCTACTCGAGTAGGAACTGATCTGCGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-671s1c1
Sequence:CCGGGCTTCTGAGTTCACCCATGTTCTCGAGAACATGGGTGAACTCAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009747
BDKRB2 MISSION shRNA shRNA Plasmid DNA
bradykinin receptor B2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009747.2-265s21c1
Sequence:CCGGAGTGGTGGAGTTGGCTCAATGCTCGAGCATTGAGCCAACTCCACCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009747.2-1483s21c1
Sequence:CCGGTACTGACTGACGCTCTAATTCCTCGAGGAATTAGAGCGTCAGTCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009747.2-860s21c1
Sequence:CCGGGGTGCTGAGGAACAACGAGATCTCGAGATCTCGTTGTTCCTCAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009747.2-1420s1c1
Sequence:CCGGCCTGTCTCATGGCATAAGCATCTCGAGATGCTTATGCCATGAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-351s1c1
Sequence:CCGGAGCGTGTTCTTCCTGCACAAACTCGAGTTTGTGCAGGAAGAACACGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-518s1c1
Sequence:CCGGCATGATCTACATGAACCTGTACTCGAGTACAGGTTCATGTAGATCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-1049s1c1
Sequence:CCGGCATCACGCAGATCAGTTCCTACTCGAGTAGGAACTGATCTGCGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-671s1c1
Sequence:CCGGGCTTCTGAGTTCACCCATGTTCTCGAGAACATGGGTGAACTCAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009747
BDKRB2 MISSION shRNA Lentiviral Transduction Particles
bradykinin receptor B2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009747.2-265s21c1
Sequence:CCGGAGTGGTGGAGTTGGCTCAATGCTCGAGCATTGAGCCAACTCCACCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009747.2-1483s21c1
Sequence:CCGGTACTGACTGACGCTCTAATTCCTCGAGGAATTAGAGCGTCAGTCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009747.2-860s21c1
Sequence:CCGGGGTGCTGAGGAACAACGAGATCTCGAGATCTCGTTGTTCCTCAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009747.2-1420s1c1
Sequence:CCGGCCTGTCTCATGGCATAAGCATCTCGAGATGCTTATGCCATGAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-351s1c1
Sequence:CCGGAGCGTGTTCTTCCTGCACAAACTCGAGTTTGTGCAGGAAGAACACGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-518s1c1
Sequence:CCGGCATGATCTACATGAACCTGTACTCGAGTACAGGTTCATGTAGATCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-1049s1c1
Sequence:CCGGCATCACGCAGATCAGTTCCTACTCGAGTAGGAACTGATCTGCGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009747.2-671s1c1
Sequence:CCGGGCTTCTGAGTTCACCCATGTTCTCGAGAACATGGGTGAACTCAGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000623
BDKRB2 MISSION shRNA Bacterial Glycerol Stock
bradykinin receptor B2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000623.3-586s21c1
Sequence:CCGGCCGCGTGGTGAATGCCATTATCTCGAGATAATGGCATTCACCACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000623.3-292s21c1
Sequence:CCGGCTTGCAAGGGCCCACTCTTAACTCGAGTTAAGAGTGGGCCCTTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000623.3-1803s21c1
Sequence:CCGGCTGGGTTTCTTTAATCTATTCCTCGAGGAATAGATTAAAGAAACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000623.2-1770s1c1
Sequence:CCGGGCTAGAACTTTGAAGGACAATCTCGAGATTGTCCTTCAAAGTTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-352s1c1
Sequence:CCGGGCCACCCTAGAGAACATCTTTCTCGAGAAAGATGTTCTCTAGGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-1059s1c1
Sequence:CCGGCGAGCGCATCATCGATGTAATCTCGAGATTACATCGATGATGCGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-247s1c1
Sequence:CCGGCCCACTCTTAACGGGACCTTTCTCGAGAAAGGTCCCGTTAAGAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-540s1c1
Sequence:CCGGGAATGCCATTATCTCCATGAACTCGAGTTCATGGAGATAATGGCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000623
BDKRB2 MISSION shRNA shRNA Plasmid DNA
bradykinin receptor B2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000623.3-586s21c1
Sequence:CCGGCCGCGTGGTGAATGCCATTATCTCGAGATAATGGCATTCACCACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000623.3-292s21c1
Sequence:CCGGCTTGCAAGGGCCCACTCTTAACTCGAGTTAAGAGTGGGCCCTTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000623.3-1803s21c1
Sequence:CCGGCTGGGTTTCTTTAATCTATTCCTCGAGGAATAGATTAAAGAAACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000623.2-1770s1c1
Sequence:CCGGGCTAGAACTTTGAAGGACAATCTCGAGATTGTCCTTCAAAGTTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-352s1c1
Sequence:CCGGGCCACCCTAGAGAACATCTTTCTCGAGAAAGATGTTCTCTAGGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-1059s1c1
Sequence:CCGGCGAGCGCATCATCGATGTAATCTCGAGATTACATCGATGATGCGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-247s1c1
Sequence:CCGGCCCACTCTTAACGGGACCTTTCTCGAGAAAGGTCCCGTTAAGAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-540s1c1
Sequence:CCGGGAATGCCATTATCTCCATGAACTCGAGTTCATGGAGATAATGGCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000623
BDKRB2 MISSION shRNA Lentiviral Transduction Particles
bradykinin receptor B2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000623.3-586s21c1
Sequence:CCGGCCGCGTGGTGAATGCCATTATCTCGAGATAATGGCATTCACCACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000623.3-292s21c1
Sequence:CCGGCTTGCAAGGGCCCACTCTTAACTCGAGTTAAGAGTGGGCCCTTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000623.3-1803s21c1
Sequence:CCGGCTGGGTTTCTTTAATCTATTCCTCGAGGAATAGATTAAAGAAACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000623.2-1770s1c1
Sequence:CCGGGCTAGAACTTTGAAGGACAATCTCGAGATTGTCCTTCAAAGTTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-352s1c1
Sequence:CCGGGCCACCCTAGAGAACATCTTTCTCGAGAAAGATGTTCTCTAGGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-1059s1c1
Sequence:CCGGCGAGCGCATCATCGATGTAATCTCGAGATTACATCGATGATGCGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-247s1c1
Sequence:CCGGCCCACTCTTAACGGGACCTTTCTCGAGAAAGGTCCCGTTAAGAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000623.2-540s1c1
Sequence:CCGGGAATGCCATTATCTCCATGAACTCGAGTTCATGGAGATAATGGCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)