EMAIL THIS PAGE TO A FRIEND

BDNF

brain-derived neurotrophic factor

276 Gene Product Result for
Synonyms: ANON2 BULN2
Gene ID:
Human(627) Summary: The protein encoded by this gene is a member of the nerve growth factor family. It is induced by cortical neurons, and is necessary for survival of striatal neurons in the brain. Expression of this gene is reduced in both Alzheimer's and Huntington disease patients. This gene may play a role in the regulation of stress response and in the biology of mood disorders. Multiple transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Jan 2009]
Mouse(12064) brain derived neurotrophic factor
Rat(24225) brain-derived neurotrophic factor
naked mole-rat(101704465) brain-derived neurotrophic factor
domestic guinea pig(100135487) brain derived neurotrophic factor
domestic guinea pig(100730257) brain-derived neurotrophic factor
sheep(101117275) brain-derived neurotrophic factor
Zebrafish(58118) brain-derived neurotrophic factor
dog(403461) brain-derived neurotrophic factor
Horse(100009689) brain-derived neurotrophic factor
domestic cat(493690) brain-derived neurotrophic factor
chicken(396186) brain-derived neurotrophic factor
cow(617701) brain-derived neurotrophic factor
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405514 Anti-BDNF antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB2108004 Anti-BDNF antibody produced in rabbit canine, rat, rabbit, mouse, human, horse
immunohistochemistry, western blot pricing
AV41970 Anti-BDNF antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, canine, rat, horse, human, rabbit
western blot pricing
HPA031440 Anti-BDNF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA056104 Anti-BDNF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4200744 Anti-BDNF antibody, Mouse Monoclonal clone BDNF129-13, purified from hybridoma cell culture New human
immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
B9186 Anti-Brain-derived Neurotrophic Factor antibody produced in chicken affinity isolated antibody, lyophilized powder human
flow cytometry, immunohistochemistry pricing
P1374 Anti-Pro-BDNF antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, mouse, human
western blot pricing
SAB1402127 Monoclonal Anti-BDNF antibody produced in mouse clone 1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
B5050 Monoclonal Anti-Brain-derived Neurotrophic Factor antibody produced in mouse clone 35928.11, purified immunoglobulin, lyophilized powder human
immunohistochemistry, western blot pricing
B9436 Monoclonal Anti-Brain-derived Neurotrophic Factor antibody produced in mouse clone 37141, purified immunoglobulin, lyophilized powder human
western blot pricing
B9561 Monoclonal Anti-Brain-derived Neurotrophic Factor antibody produced in mouse clone 35909, purified immunoglobulin, lyophilized powder human
flow cytometry pricing
B9686 Monoclonal Anti-Brain-derived Neurotrophic Factor antibody produced in mouse clone 37129, purified immunoglobulin, lyophilized powder human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MABN114 Anti-BDNF Antibody, clone 1G10.2 100 μg, Detect BDNF using this Anti-BDNF Antibody, clone 1G10.2 validated for use in Western Blotting, Immunohistochemistry (Paraffin). pricing
MABN79 Anti-BDNF Antibody, clone 8G8.2 200 µL, Anti-BDNF Antibody, clone 8G8.2 is an antibody against BDNF for use in Western Blotting. pricing
AB1513 Anti-Brain Derived Neurotrophic Factor Antibody 100 µL, Anti-Brain Derived Neurotrophic Factor Antibody is an antibody against Brain Derived Neurotrophic Factor for use in ELISA, WB, IH. pricing
AB1513P Anti-Brain Derived Neurotrophic Factor Antibody 500 µg, Anti-Brain Derived Neurotrophic Factor Antibody detects level of Brain Derived Neurotrophic Factor & has been published & validated for use in ELISA, IH, FUNC & WB. pricing
AB1534 Anti-Brain Derived Neurotrophic Factor Antibody 50 µL, This Anti-Brain Derived Neurotrophic Factor Antibody is validated for use in ELISA, IH, WB for the detection of Brain Derived Neurotrophic Factor. pricing
AB1534SP Anti-Brain Derived Neurotrophic Factor Antibody 500 µg, Anti-Brain Derived Neurotrophic Factor Antibody is an antibody against Brain Derived Neurotrophic Factor for use in ELISA, IH & WB. pricing
AB1779 Anti-Brain Derived Neurotrophic Factor Antibody 50 µL, Detect Brain Derived Neurotrophic Factor using this Anti-Brain Derived Neurotrophic Factor Antibody validated for use in WB, IH. pricing
AB1779SP Anti-Brain Derived Neurotrophic Factor Antibody 500 µg, Anti-Brain Derived Neurotrophic Factor Antibody detects level of Brain Derived Neurotrophic Factor & has been published & validated for use in ELISA, WB, IH. pricing
AB9612 Anti-Brain Derived Neurotrophic Factor Antibody 50 µL, This Anti-Brain Derived Neurotrophic Factor Antibody is validated for use in WB for the detection of Brain Derived Neurotrophic Factor. pricing
AB5613 Anti-Brain Derived Neurotrophic Factor Antibody, pro 50 µL, Anti-Brain Derived Neurotrophic Factor Antibody, pro is an antibody proBDNF for use in Immunohistochemistry and Western Blotting. pricing
AB5613P Anti-Brain Derived Neurotrophic Factor Antibody, pro 20 µg, Anti-Brain Derived Neurotrophic Factor Antibody, pro is an antibody proBDNF for use in Immunohistochemistry and Western Blotting. pricing
AB9042 Anti-Brain Derived Neurotrophic Factor Antibody, pro 100 µL, Anti-Brain Derived Neurotrophic Factor Antibody, pro detects level of Brain Derived Neurotrophic Factor & has been published & validated for use in IP, WB, IH. pricing
MABN110 Anti-pro-BDNF Antibody, clone 5D4.1 100 µg, This Anti-pro-BDNF Antibody, clone 5D4.1 is validated for use in Western Blotting and Immunohistochemistry (Paraffin) for the detection of pro-BDNF. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001709 Rosetta Predictions human pricing
NM_170731 Rosetta Predictions human pricing
NM_170732 Rosetta Predictions human pricing
NM_170733 Rosetta Predictions human pricing
NM_170734 Rosetta Predictions human pricing
NM_170735 Rosetta Predictions human pricing
NM_012513 Rosetta Predictions rat pricing
NM_001048139 Rosetta Predictions mouse pricing
NM_001048141 Rosetta Predictions mouse pricing
NM_001048142 Rosetta Predictions mouse pricing
NM_007540 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111694 predicted 806
2 SASI_Hs01_00111695 predicted 936
3 SASI_Hs01_00111696 predicted 965
4 SASI_Hs01_00111697 predicted 463
5 SASI_Hs01_00111698 predicted 978
6 SASI_Hs01_00111699 predicted 726
7 SASI_Hs01_00111700 predicted 718
8 SASI_Hs01_00111701 predicted 958
9 SASI_Hs01_00111702 predicted 754
10 SASI_Hs01_00111703 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194263 predicted 877
2 SASI_Hs01_00194264 predicted 1003
3 SASI_Hs01_00194265 predicted 1040
4 SASI_Hs01_00194266 predicted 534
5 SASI_Hs01_00194267 predicted 1053
6 SASI_Hs01_00194268 predicted 793
7 SASI_Hs01_00194269 predicted 792
8 SASI_Hs01_00194270 predicted 1027
9 SASI_Hs01_00194271 predicted 823
10 SASI_Hs01_00194272 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133980 predicted 915
2 SASI_Hs01_00133981 predicted 1045
3 SASI_Hs01_00133982 predicted 1074
4 SASI_Hs01_00133983 predicted 578
5 SASI_Hs01_00133984 predicted 1094
6 SASI_Hs01_00133985 predicted 833
7 SASI_Hs01_00133986 predicted 832
8 SASI_Hs01_00133987 predicted 1065
9 SASI_Hs01_00133988 predicted 867
10 SASI_Hs01_00133989 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106227 predicted 854
2 SASI_Hs01_00106228 predicted 978
3 SASI_Hs01_00106229 predicted 1011
4 SASI_Hs01_00106230 predicted 507
5 SASI_Hs01_00106231 predicted 1026
6 SASI_Hs01_00106232 predicted 768
7 SASI_Hs01_00106233 predicted 761
8 SASI_Hs01_00106234 predicted 997
9 SASI_Hs01_00106235 predicted 797
10 SASI_Hs01_00106236 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115405 predicted 789
2 SASI_Hs01_00115406 predicted 917
3 SASI_Hs01_00115407 predicted 951
4 SASI_Hs01_00115408 predicted 455
5 SASI_Hs01_00115409 predicted 959
6 SASI_Hs01_00115410 predicted 704
7 SASI_Hs01_00115411 predicted 703
8 SASI_Hs01_00115412 predicted 937
9 SASI_Hs01_00115413 predicted 733
10 SASI_Hs01_00115414 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079140 predicted 1076
2 SASI_Hs01_00079141 predicted 1211
3 SASI_Hs01_00079142 predicted 1237
4 SASI_Hs01_00079143 predicted 742
5 SASI_Hs01_00079144 predicted 1253
6 SASI_Hs01_00079145 predicted 999
7 SASI_Hs01_00079146 predicted 994
8 SASI_Hs01_00079147 predicted 1231
9 SASI_Hs01_00079148 predicted 1025
10 SASI_Hs01_00079149 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075927 predicted 1404
2 SASI_Rn02_00259567 predicted 1271
3 SASI_Rn01_00075929 predicted 1162
4 SASI_Rn02_00259568 predicted 1159
5 SASI_Rn02_00259569 predicted 1126
6 SASI_Rn01_00075932 predicted 1296
7 SASI_Rn02_00259570 predicted 1419
8 SASI_Rn02_00259571 predicted 1149
9 SASI_Rn02_00259572 predicted 1397
10 SASI_Rn02_00259573 predicted 1471
11 SASI_Rn01_00075925 predicted 935
12 SASI_Rn01_00075926 predicted 805
13 SASI_Rn01_00075928 predicted 903
14 SASI_Rn01_00075930 predicted 968
15 SASI_Rn01_00075931 predicted 882
16 SASI_Rn01_00075933 predicted 273
17 SASI_Rn01_00075934 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292011 predicted 1063
2 SASI_Mm02_00292012 predicted 1264
3 SASI_Mm02_00292013 predicted 1173
4 SASI_Mm02_00292014 predicted 1201
5 SASI_Mm02_00292015 predicted 1027
6 SASI_Mm02_00292016 predicted 1237
7 SASI_Mm02_00292017 predicted 1196
8 SASI_Mm02_00292018 predicted 986
9 SASI_Mm02_00292019 predicted 1032
10 SASI_Mm02_00292020 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292021 predicted 906
2 SASI_Mm02_00292022 predicted 1101
3 SASI_Mm02_00292023 predicted 1010
4 SASI_Mm02_00292024 predicted 1044
5 SASI_Mm02_00292025 predicted 866
6 SASI_Mm02_00292026 predicted 1075
7 SASI_Mm02_00292027 predicted 1031
8 SASI_Mm02_00292028 predicted 832
9 SASI_Mm02_00292029 predicted 876
10 SASI_Mm02_00292030 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292031 predicted 915
2 SASI_Mm02_00292032 predicted 1113
3 SASI_Mm02_00292033 predicted 1020
4 SASI_Mm02_00292034 predicted 1057
5 SASI_Mm02_00292035 predicted 867
6 SASI_Mm02_00292036 predicted 1082
7 SASI_Mm02_00292037 predicted 1041
8 SASI_Mm02_00292038 predicted 834
9 SASI_Mm02_00292039 predicted 878
10 SASI_Mm02_00292040 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099711 predicted 1205
2 SASI_Mm01_00099713 predicted 1400
3 SASI_Mm01_00099714 predicted 1315
4 SASI_Mm01_00099715 predicted 1351
5 SASI_Mm01_00099716 predicted 1160
6 SASI_Mm01_00099718 predicted 1373
7 SASI_Mm01_00099719 predicted 1335
8 SASI_Mm01_00099720 predicted 1127
9 SASI_Mm02_00311878 predicted 1174
10 SASI_Mm02_00311879 predicted 1286
11 SASI_Mm01_00099712 predicted 950
12 SASI_Mm01_00099717 predicted 1206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001709
VALIDATED
BDNF MISSION shRNA Bacterial Glycerol Stock
brain-derived neurotrophic factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-572s1c1
Sequence:CCGGGCTCAGTAGTCAAGTGCCTTTCTCGAGAAAGGCACTTGACTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-821s1c1
Sequence:CCGGGCAATACTTCTACGAGACCAACTCGAGTTGGTCTCGTAGAAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001709.3-354s1c1
Sequence:CCGGGAAGCAAACATCCGAGGACAACTCGAGTTGTCCTCGGATGTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-495s1c1
Sequence:CCGGCTGTTGGATGAGGACCAGAAACTCGAGTTTCTGGTCCTCATCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001709.3-936s1c1
Sequence:CCGGGCCCTTACCATGGATAGCAAACTCGAGTTTGCTATCCATGGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1225s21c1
Sequence:CCGGACAGTGGTTCTACAATCTATTCTCGAGAATAGATTGTAGAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1020s21c1
Sequence:CCGGGAATTGGCTGGCGATTCATAACTCGAGTTATGAATCGCCAGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1058s21c1
Sequence:CCGGGTATGTACATTGACCATTAAACTCGAGTTTAATGGTCAATGTACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001709
VALIDATED
BDNF MISSION shRNA shRNA Plasmid DNA
brain-derived neurotrophic factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-572s1c1
Sequence:CCGGGCTCAGTAGTCAAGTGCCTTTCTCGAGAAAGGCACTTGACTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-821s1c1
Sequence:CCGGGCAATACTTCTACGAGACCAACTCGAGTTGGTCTCGTAGAAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001709.3-354s1c1
Sequence:CCGGGAAGCAAACATCCGAGGACAACTCGAGTTGTCCTCGGATGTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-495s1c1
Sequence:CCGGCTGTTGGATGAGGACCAGAAACTCGAGTTTCTGGTCCTCATCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001709.3-936s1c1
Sequence:CCGGGCCCTTACCATGGATAGCAAACTCGAGTTTGCTATCCATGGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1225s21c1
Sequence:CCGGACAGTGGTTCTACAATCTATTCTCGAGAATAGATTGTAGAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1020s21c1
Sequence:CCGGGAATTGGCTGGCGATTCATAACTCGAGTTATGAATCGCCAGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1058s21c1
Sequence:CCGGGTATGTACATTGACCATTAAACTCGAGTTTAATGGTCAATGTACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001709
VALIDATED
BDNF MISSION shRNA Lentiviral Transduction Particles
brain-derived neurotrophic factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-572s1c1
Sequence:CCGGGCTCAGTAGTCAAGTGCCTTTCTCGAGAAAGGCACTTGACTACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-821s1c1
Sequence:CCGGGCAATACTTCTACGAGACCAACTCGAGTTGGTCTCGTAGAAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001709.3-354s1c1
Sequence:CCGGGAAGCAAACATCCGAGGACAACTCGAGTTGTCCTCGGATGTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001709.3-495s1c1
Sequence:CCGGCTGTTGGATGAGGACCAGAAACTCGAGTTTCTGGTCCTCATCCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001709.3-936s1c1
Sequence:CCGGGCCCTTACCATGGATAGCAAACTCGAGTTTGCTATCCATGGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371421    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1225s21c1
Sequence:CCGGACAGTGGTTCTACAATCTATTCTCGAGAATAGATTGTAGAACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1020s21c1
Sequence:CCGGGAATTGGCTGGCGATTCATAACTCGAGTTATGAATCGCCAGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_001709.4-1058s21c1
Sequence:CCGGGTATGTACATTGACCATTAAACTCGAGTTTAATGGTCAATGTACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007540
BDNF MISSION shRNA Bacterial Glycerol Stock
brain-derived neurotrophic factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1316s1c1
Sequence:CCGGGCCCTTACTATGGATAGCAAACTCGAGTTTGCTATCCATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1201s1c1
Sequence:CCGGGCAGTATTTCTACGAGACCAACTCGAGTTGGTCTCGTAGAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1218s1c1
Sequence:CCGGCCAAGTGTAATCCCATGGGTTCTCGAGAACCCATGGGATTACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1164s1c1
Sequence:CCGGTCCTAGAGAAAGTCCCGGTATCTCGAGATACCGGGACTTTCTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-728s1c1
Sequence:CCGGGAAGTAAACGTCCACGGACAACTCGAGTTGTCCGTGGACGTTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1208s21c1
Sequence:GTACCGGTTCTACGAGACCAAGTGTAATCTCGAGATTACACTTGGTCTCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007540.4-2059s21c1
Sequence:GTACCGGACTATCCATTCTGGTTGATAACTCGAGTTATCAACCAGAATGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1341s21c1
Sequence:CCGGGAATTGGCTGGCGATTCATAACTCGAGTTATGAATCGCCAGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1080s21c1
Sequence:CCGGTGAGCGTGTGTGACAGTATTACTCGAGTAATACTGTCACACACGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-673s21c1
Sequence:CCGGTTTCCTTACTATGGTTATTTCCTCGAGGAAATAACCATAGTAAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007540
BDNF MISSION shRNA shRNA Plasmid DNA
brain-derived neurotrophic factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1316s1c1
Sequence:CCGGGCCCTTACTATGGATAGCAAACTCGAGTTTGCTATCCATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1201s1c1
Sequence:CCGGGCAGTATTTCTACGAGACCAACTCGAGTTGGTCTCGTAGAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1218s1c1
Sequence:CCGGCCAAGTGTAATCCCATGGGTTCTCGAGAACCCATGGGATTACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1164s1c1
Sequence:CCGGTCCTAGAGAAAGTCCCGGTATCTCGAGATACCGGGACTTTCTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-728s1c1
Sequence:CCGGGAAGTAAACGTCCACGGACAACTCGAGTTGTCCGTGGACGTTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1208s21c1
Sequence:GTACCGGTTCTACGAGACCAAGTGTAATCTCGAGATTACACTTGGTCTCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007540.4-2059s21c1
Sequence:GTACCGGACTATCCATTCTGGTTGATAACTCGAGTTATCAACCAGAATGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1341s21c1
Sequence:CCGGGAATTGGCTGGCGATTCATAACTCGAGTTATGAATCGCCAGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1080s21c1
Sequence:CCGGTGAGCGTGTGTGACAGTATTACTCGAGTAATACTGTCACACACGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-673s21c1
Sequence:CCGGTTTCCTTACTATGGTTATTTCCTCGAGGAAATAACCATAGTAAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007540
BDNF MISSION shRNA Lentiviral Transduction Particles
brain-derived neurotrophic factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1316s1c1
Sequence:CCGGGCCCTTACTATGGATAGCAAACTCGAGTTTGCTATCCATAGTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1201s1c1
Sequence:CCGGGCAGTATTTCTACGAGACCAACTCGAGTTGGTCTCGTAGAAATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1218s1c1
Sequence:CCGGCCAAGTGTAATCCCATGGGTTCTCGAGAACCCATGGGATTACACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-1164s1c1
Sequence:CCGGTCCTAGAGAAAGTCCCGGTATCTCGAGATACCGGGACTTTCTCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007540.3-728s1c1
Sequence:CCGGGAAGTAAACGTCCACGGACAACTCGAGTTGTCCGTGGACGTTTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1208s21c1
Sequence:GTACCGGTTCTACGAGACCAAGTGTAATCTCGAGATTACACTTGGTCTCGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218717    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007540.4-2059s21c1
Sequence:GTACCGGACTATCCATTCTGGTTGATAACTCGAGTTATCAACCAGAATGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1341s21c1
Sequence:CCGGGAATTGGCTGGCGATTCATAACTCGAGTTATGAATCGCCAGCCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-1080s21c1
Sequence:CCGGTGAGCGTGTGTGACAGTATTACTCGAGTAATACTGTCACACACGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007540.4-673s21c1
Sequence:CCGGTTTCCTTACTATGGTTATTTCCTCGAGGAAATAACCATAGTAAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks