EMAIL THIS PAGE TO A FRIEND

BDP1

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

280 Gene Product Result for
Synonyms: HSA238520 TAF3B1 TFC5 TFIIIB'' TFIIIB150 TFIIIB90 TFNR
Gene ID:
Human(55814) Summary: The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Mouse(544971) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Rat(294687) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
chicken(769916) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
dog(478090) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
cow(519320) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
domestic cat(101095226) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
domestic guinea pig(100734392) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
naked mole-rat(101708558) B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018429 Rosetta Predictions human pricing
NM_001106403 Rosetta Predictions rat pricing
NM_001081061 Rosetta Predictions mouse pricing
XM_001474306 Rosetta Predictions mouse pricing
XM_127501 Rosetta Predictions mouse pricing
XM_897022 Rosetta Predictions mouse pricing
XM_914676 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351948 predicted 2739
2 SASI_Hs01_00030903 predicted 1617
3 SASI_Hs01_00030904 predicted 3098
4 SASI_Hs01_00030907 predicted 1667
5 SASI_Hs02_00351949 predicted 3428
6 SASI_Hs02_00351950 predicted 6289
7 SASI_Hs02_00351951 predicted 7217
8 SASI_Hs01_00030909 predicted 4263
9 SASI_Hs01_00030910 predicted 2943
10 SASI_Hs02_00351952 predicted 7855
11 SASI_Hs01_00030902 predicted 2919
12 SASI_Hs01_00030905 predicted 2696
13 SASI_Hs01_00030906 predicted 6108
14 SASI_Hs01_00030908 predicted 4241
15 SASI_Hs01_00030911 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218618 predicted 6715
2 SASI_Rn02_00218619 predicted 2739
3 SASI_Rn02_00218620 predicted 5523
4 SASI_Rn02_00218621 predicted 3878
5 SASI_Rn02_00218622 predicted 3942
6 SASI_Rn02_00218623 predicted 6632
7 SASI_Rn02_00218624 predicted 6394
8 SASI_Rn02_00218625 predicted 4179
9 SASI_Rn02_00218626 predicted 6753
10 SASI_Rn02_00218627 predicted 5363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294791 predicted 2640
2 SASI_Mm02_00294792 predicted 6493
3 SASI_Mm02_00294793 predicted 6902
4 SASI_Mm02_00294794 predicted 6550
5 SASI_Mm02_00294795 predicted 7132
6 SASI_Mm02_00294796 predicted 659
7 SASI_Mm02_00294797 predicted 2336
8 SASI_Mm02_00294798 predicted 2295
9 SASI_Mm02_00294799 predicted 2088
10 SASI_Mm02_00294800 predicted 3579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001474306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00374430 predicted 2641
2 SASI_Mm02_00374431 predicted 6498
3 SASI_Mm02_00374432 predicted 6906
4 SASI_Mm02_00374433 predicted 6542
5 SASI_Mm02_00374434 predicted 7128
6 SASI_Mm02_00374435 predicted 656
7 SASI_Mm02_00374436 predicted 2335
8 SASI_Mm02_00374437 predicted 2292
9 SASI_Mm02_00374438 predicted 2088
10 SASI_Mm02_00374439 predicted 3578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251024 predicted 2638
2 SASI_Mm01_00251025 predicted 6504
3 SASI_Mm01_00251026 predicted 6915
4 SASI_Mm01_00251027 predicted 7135
5 SASI_Mm01_00251028 predicted 667
6 SASI_Mm01_00251029 predicted 2339
7 SASI_Mm01_00251030 predicted 2301
8 SASI_Mm01_00251031 predicted 5418
9 SASI_Mm01_00251032 predicted 2086
10 SASI_Mm01_00251033 predicted 3586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236135 predicted 291
2 SASI_Mm01_00236136 predicted 362
3 SASI_Mm01_00236137 predicted 333
4 SASI_Mm01_00236138 predicted 299
5 SASI_Mm01_00236139 predicted 358
6 SASI_Mm01_00236140 predicted 394
7 SASI_Mm01_00236141 predicted 361
8 SASI_Mm01_00236142 predicted 303
9 SASI_Mm01_00236143 predicted 295
10 SASI_Mm01_00236144 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438803 predicted 6492
2 SASI_Mm02_00438804 predicted 6912
3 SASI_Mm02_00438805 predicted 6553
4 SASI_Mm02_00438806 predicted 7130
5 SASI_Mm02_00438807 predicted 657
6 SASI_Mm02_00438808 predicted 2332
7 SASI_Mm02_00438809 predicted 2294
8 SASI_Mm02_00438810 predicted 5421
9 SASI_Mm02_00438811 predicted 2088
10 SASI_Mm02_00438812 predicted 3582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018429
VALIDATED
BDP1 MISSION shRNA Bacterial Glycerol Stock
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-5047s21c1
Sequence:CCGGGTGAAGCCAAAGGCATAATTACTCGAGTAATTATGCCTTTGGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-3832s21c1
Sequence:CCGGTTGATGCTGCTGAGGTAATAGCTCGAGCTATTACCTCAGCAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-1623s21c1
Sequence:CCGGGCATTAGAAGTAGACCTAAATCTCGAGATTTAGGTCTACTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018429.1-7034s1c1
Sequence:CCGGCTTCACCTCTTTTATCTTCATCTCGAGATGAAGATAAAAGAGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018429.1-2616s1c1
Sequence:CCGGCCCAATTCTAAGGACTCGATTCTCGAGAATCGAGTCCTTAGAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018429.1-6845s1c1
Sequence:CCGGCCTGCACACTTGGTTTGGATACTCGAGTATCCAAACCAAGTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018429.1-3389s1c1
Sequence:CCGGCGGATTTGAAAGCAACTGGAACTCGAGTTCCAGTTGCTTTCAAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018429.1-1056s1c1
Sequence:CCGGGCGCGGTTCTACAACTACATACTCGAGTATGTAGTTGTAGAACCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018429
VALIDATED
BDP1 MISSION shRNA shRNA Plasmid DNA
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-5047s21c1
Sequence:CCGGGTGAAGCCAAAGGCATAATTACTCGAGTAATTATGCCTTTGGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-3832s21c1
Sequence:CCGGTTGATGCTGCTGAGGTAATAGCTCGAGCTATTACCTCAGCAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-1623s21c1
Sequence:CCGGGCATTAGAAGTAGACCTAAATCTCGAGATTTAGGTCTACTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018429.1-7034s1c1
Sequence:CCGGCTTCACCTCTTTTATCTTCATCTCGAGATGAAGATAAAAGAGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018429.1-2616s1c1
Sequence:CCGGCCCAATTCTAAGGACTCGATTCTCGAGAATCGAGTCCTTAGAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018429.1-6845s1c1
Sequence:CCGGCCTGCACACTTGGTTTGGATACTCGAGTATCCAAACCAAGTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018429.1-3389s1c1
Sequence:CCGGCGGATTTGAAAGCAACTGGAACTCGAGTTCCAGTTGCTTTCAAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018429.1-1056s1c1
Sequence:CCGGGCGCGGTTCTACAACTACATACTCGAGTATGTAGTTGTAGAACCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018429
VALIDATED
BDP1 MISSION shRNA Lentiviral Transduction Particles
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-5047s21c1
Sequence:CCGGGTGAAGCCAAAGGCATAATTACTCGAGTAATTATGCCTTTGGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-3832s21c1
Sequence:CCGGTTGATGCTGCTGAGGTAATAGCTCGAGCTATTACCTCAGCAGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018429.2-1623s21c1
Sequence:CCGGGCATTAGAAGTAGACCTAAATCTCGAGATTTAGGTCTACTTCTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021109    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018429.1-7034s1c1
Sequence:CCGGCTTCACCTCTTTTATCTTCATCTCGAGATGAAGATAAAAGAGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018429.1-2616s1c1
Sequence:CCGGCCCAATTCTAAGGACTCGATTCTCGAGAATCGAGTCCTTAGAATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018429.1-6845s1c1
Sequence:CCGGCCTGCACACTTGGTTTGGATACTCGAGTATCCAAACCAAGTGTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018429.1-3389s1c1
Sequence:CCGGCGGATTTGAAAGCAACTGGAACTCGAGTTCCAGTTGCTTTCAAATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018429.1-1056s1c1
Sequence:CCGGGCGCGGTTCTACAACTACATACTCGAGTATGTAGTTGTAGAACCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081061
VALIDATED
BDP1 MISSION shRNA Bacterial Glycerol Stock
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-4311s21c1
Sequence:CCGGAGGATGCTTCACCGCCAAATTCTCGAGAATTTGGCGGTGAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-7357s21c1
Sequence:CCGGACCTGTATCACGGCGAAATTTCTCGAGAAATTTCGCCGTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081061.1-1066s21c1
Sequence:CCGGTGAAGAGAATGATCCTATATTCTCGAGAATATAGGATCATTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081061.1-8236s21c1
Sequence:CCGGCTGATTGAAGATCTAGTATTTCTCGAGAAATACTAGATCTTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-6688s21c1
Sequence:CCGGTCTGCTGCCAGCACCTATATTCTCGAGAATATAGGTGCTGGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081061
VALIDATED
BDP1 MISSION shRNA shRNA Plasmid DNA
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-4311s21c1
Sequence:CCGGAGGATGCTTCACCGCCAAATTCTCGAGAATTTGGCGGTGAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-7357s21c1
Sequence:CCGGACCTGTATCACGGCGAAATTTCTCGAGAAATTTCGCCGTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081061.1-1066s21c1
Sequence:CCGGTGAAGAGAATGATCCTATATTCTCGAGAATATAGGATCATTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081061.1-8236s21c1
Sequence:CCGGCTGATTGAAGATCTAGTATTTCTCGAGAAATACTAGATCTTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-6688s21c1
Sequence:CCGGTCTGCTGCCAGCACCTATATTCTCGAGAATATAGGTGCTGGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081061
VALIDATED
BDP1 MISSION shRNA Lentiviral Transduction Particles
B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-4311s21c1
Sequence:CCGGAGGATGCTTCACCGCCAAATTCTCGAGAATTTGGCGGTGAAGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-7357s21c1
Sequence:CCGGACCTGTATCACGGCGAAATTTCTCGAGAAATTTCGCCGTGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081061.1-1066s21c1
Sequence:CCGGTGAAGAGAATGATCCTATATTCTCGAGAATATAGGATCATTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254971    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081061.1-8236s21c1
Sequence:CCGGCTGATTGAAGATCTAGTATTTCTCGAGAAATACTAGATCTTCAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081061.1-6688s21c1
Sequence:CCGGTCTGCTGCCAGCACCTATATTCTCGAGAATATAGGTGCTGGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks