EMAIL THIS PAGE TO A FRIEND

BEAN1

brain expressed, associated with NEDD4, 1

240 Gene Product Result for
Synonyms: BEAN SCA31
UniProtKB ID: Q3B7T3, B3KPC0, H3BP97
Gene ID:
Human(146227) Summary: The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(65115) brain expressed, associated with Nedd4, 1
Rat(361358) brain expressed, associated with NEDD4, 1
chicken(415796) brain expressed, associated with NEDD4, 1
domestic cat(101084757) brain expressed, associated with NEDD4, 1
cow(100297073) brain expressed, associated with NEDD4, 1
dog(100686400) brain expressed, associated with NEDD4, 1
naked mole-rat(101706212) brain expressed, associated with NEDD4, 1
domestic guinea pig(100716086) brain expressed, associated with NEDD4, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001141922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001141922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001141922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717857 Rosetta Predictions human pricing
XM_001719451 Rosetta Predictions human pricing
XM_001723219 Rosetta Predictions human pricing
XM_375359 Rosetta Predictions human pricing
XM_001057606 Rosetta Predictions rat pricing
XM_341638 Rosetta Predictions rat pricing
XM_486154 Rosetta Predictions mouse pricing
XM_913080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420003 predicted 1383
2 SASI_Hs02_00420004 predicted 1306
3 SASI_Hs02_00420005 predicted 1207
4 SASI_Hs02_00420006 predicted 220
5 SASI_Hs02_00420007 predicted 687
6 SASI_Hs02_00420008 predicted 613
7 SASI_Hs02_00420009 predicted 1374
8 SASI_Hs02_00420010 predicted 1161
9 SASI_Hs02_00420011 predicted 308
10 SASI_Hs02_00420012 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00430526 predicted 1642
2 SASI_Hs02_00430527 predicted 1571
3 SASI_Hs02_00430528 predicted 1476
4 SASI_Hs02_00430529 predicted 482
5 SASI_Hs02_00430530 predicted 952
6 SASI_Hs02_00430531 predicted 876
7 SASI_Hs02_00430532 predicted 1637
8 SASI_Hs02_00430533 predicted 1431
9 SASI_Hs02_00430534 predicted 577
10 SASI_Hs02_00430535 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454025 predicted 1196
2 SASI_Hs02_00454026 predicted 1117
3 SASI_Hs02_00454027 predicted 33
4 SASI_Hs02_00454028 predicted 1020
5 SASI_Hs02_00454029 predicted 501
6 SASI_Hs02_00454030 predicted 425
7 SASI_Hs02_00454031 predicted 1183
8 SASI_Hs02_00454032 predicted 972
9 SASI_Hs02_00454033 predicted 125
10 SASI_Hs02_00454034 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278832 predicted 1497
2 SASI_Hs01_00278833 predicted 935
3 SASI_Hs01_00278834 predicted 354
4 SASI_Hs01_00278835 predicted 1305
5 SASI_Hs01_00278836 predicted 826
6 SASI_Hs01_00278837 predicted 130
7 SASI_Hs01_00278838 predicted 750
8 SASI_Hs01_00278839 predicted 40
9 SASI_Hs01_00278840 predicted 447
10 SASI_Hs01_00278841 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286938 predicted 520
2 SASI_Rn02_00286939 predicted 515
3 SASI_Rn02_00286940 predicted 451
4 SASI_Rn02_00286941 predicted 518
5 SASI_Rn02_00286942 predicted 202
6 SASI_Rn02_00286943 predicted 293
7 SASI_Rn02_00286944 predicted 293
8 SASI_Rn02_00286945 predicted 444
9 SASI_Rn02_00286946 predicted 505
10 SASI_Rn02_00286947 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393191 predicted 517
2 SASI_Rn02_00393192 predicted 510
3 SASI_Rn02_00393193 predicted 455
4 SASI_Rn02_00393194 predicted 512
5 SASI_Rn02_00393195 predicted 203
6 SASI_Rn02_00393196 predicted 292
7 SASI_Rn02_00393197 predicted 296
8 SASI_Rn02_00393198 predicted 440
9 SASI_Rn02_00393199 predicted 509
10 SASI_Rn02_00393200 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426801 predicted 1380
2 SASI_Mm01_00232395 predicted 1219
3 SASI_Mm01_00232397 predicted 1186
4 SASI_Mm02_00426802 predicted 1231
5 SASI_Mm01_00232399 predicted 1256
6 SASI_Mm02_00426803 predicted 1424
7 SASI_Mm01_00232400 predicted 1301
8 SASI_Mm01_00232401 predicted 1152
9 SASI_Mm01_00232402 predicted 1308
10 SASI_Mm01_00232403 predicted 1303
11 SASI_Mm01_00232396 predicted 1138
12 SASI_Mm01_00232398 predicted 1137
13 SASI_Mm01_00232404 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437469 predicted 982
2 SASI_Mm02_00437470 predicted 1429
3 SASI_Mm02_00437471 predicted 586
4 SASI_Mm02_00437472 predicted 1034
5 SASI_Mm02_00437473 predicted 796
6 SASI_Mm02_00437474 predicted 859
7 SASI_Mm02_00437475 predicted 1111
8 SASI_Mm02_00437476 predicted 1160
9 SASI_Mm02_00437477 predicted 1016
10 SASI_Mm02_00437478 predicted 1435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136106
BEAN1 MISSION shRNA Bacterial Glycerol Stock
brain expressed, associated with NEDD4, 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-827s21c1
Sequence:CCGGTCTGGCCCAGAGAGGATTGTGCTCGAGCACAATCCTCTCTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136106.2-2251s21c1
Sequence:CCGGATGAAGGGCTAAGACTATTTACTCGAGTAAATAGTCTTAGCCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-571s21c1
Sequence:CCGGACCCTACTCGCTGACTGATTCCTCGAGGAATCAGTCAGCGAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-480s21c1
Sequence:CCGGTCAGGGAGCTGTACCCAGATTCTCGAGAATCTGGGTACAGCTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-684s21c1
Sequence:CCGGTTCACACGGTCTCCATGGACACTCGAGTGTCCATGGAGACCGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136106
BEAN1 MISSION shRNA shRNA Plasmid DNA
brain expressed, associated with NEDD4, 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-827s21c1
Sequence:CCGGTCTGGCCCAGAGAGGATTGTGCTCGAGCACAATCCTCTCTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136106.2-2251s21c1
Sequence:CCGGATGAAGGGCTAAGACTATTTACTCGAGTAAATAGTCTTAGCCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-571s21c1
Sequence:CCGGACCCTACTCGCTGACTGATTCCTCGAGGAATCAGTCAGCGAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-480s21c1
Sequence:CCGGTCAGGGAGCTGTACCCAGATTCTCGAGAATCTGGGTACAGCTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-684s21c1
Sequence:CCGGTTCACACGGTCTCCATGGACACTCGAGTGTCCATGGAGACCGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136106
BEAN1 MISSION shRNA Lentiviral Transduction Particles
brain expressed, associated with NEDD4, 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-827s21c1
Sequence:CCGGTCTGGCCCAGAGAGGATTGTGCTCGAGCACAATCCTCTCTGGGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136106.2-2251s21c1
Sequence:CCGGATGAAGGGCTAAGACTATTTACTCGAGTAAATAGTCTTAGCCCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-571s21c1
Sequence:CCGGACCCTACTCGCTGACTGATTCCTCGAGGAATCAGTCAGCGAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-480s21c1
Sequence:CCGGTCAGGGAGCTGTACCCAGATTCTCGAGAATCTGGGTACAGCTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136106.2-684s21c1
Sequence:CCGGTTCACACGGTCTCCATGGACACTCGAGTGTCCATGGAGACCGTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001141922
BEAN1 MISSION shRNA Bacterial Glycerol Stock
brain expressed, associated with NEDD4, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141922.1-2712s21c1
Sequence:CCGGATCTCCATCGAAGACTATATACTCGAGTATATAGTCTTCGATGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-675s21c1
Sequence:CCGGAGGATTACATGTCCTTCAAACCTCGAGGTTTGAAGGACATGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-716s21c1
Sequence:CCGGTACAACCGTACCAGCTATTTCCTCGAGGAAATAGCTGGTACGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-1559s21c1
Sequence:CCGGTGAGTGGCCAAGCTCATAAATCTCGAGATTTATGAGCTTGGCCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-1048s21c1
Sequence:CCGGACTGACCTTCACGAGTCTTTGCTCGAGCAAAGACTCGTGAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001141922
BEAN1 MISSION shRNA shRNA Plasmid DNA
brain expressed, associated with NEDD4, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141922.1-2712s21c1
Sequence:CCGGATCTCCATCGAAGACTATATACTCGAGTATATAGTCTTCGATGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-675s21c1
Sequence:CCGGAGGATTACATGTCCTTCAAACCTCGAGGTTTGAAGGACATGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-716s21c1
Sequence:CCGGTACAACCGTACCAGCTATTTCCTCGAGGAAATAGCTGGTACGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-1559s21c1
Sequence:CCGGTGAGTGGCCAAGCTCATAAATCTCGAGATTTATGAGCTTGGCCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-1048s21c1
Sequence:CCGGACTGACCTTCACGAGTCTTTGCTCGAGCAAAGACTCGTGAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001141922
BEAN1 MISSION shRNA Lentiviral Transduction Particles
brain expressed, associated with NEDD4, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141922.1-2712s21c1
Sequence:CCGGATCTCCATCGAAGACTATATACTCGAGTATATAGTCTTCGATGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-675s21c1
Sequence:CCGGAGGATTACATGTCCTTCAAACCTCGAGGTTTGAAGGACATGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-716s21c1
Sequence:CCGGTACAACCGTACCAGCTATTTCCTCGAGGAAATAGCTGGTACGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-1559s21c1
Sequence:CCGGTGAGTGGCCAAGCTCATAAATCTCGAGATTTATGAGCTTGGCCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141922.1-1048s21c1
Sequence:CCGGACTGACCTTCACGAGTCTTTGCTCGAGCAAAGACTCGTGAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks