EMAIL THIS PAGE TO A FRIEND

BEGAIN

brain-enriched guanylate kinase-associated

75 Gene Product Result for
UniProtKB ID: Q9BUH8, Q9NPU3, Q9P282
Gene ID:
Mouse(380785) brain-enriched guanylate kinase-associated
Rat(79146) brain-enriched guanylate kinase-associated
chicken(428909) brain-enriched guanylate kinase-associated homolog (rat)
domestic cat(101081557) brain-enriched guanylate kinase-associated homolog (rat)
cow(527886) brain-enriched guanylate kinase-associated homolog (rat)
dog(490859) brain-enriched guanylate kinase-associated homolog (rat)
sheep(443287) brain-enriched guanylate kinase-associated homolog (rat)
naked mole-rat(101702122) brain-enriched guanylate kinase-associated
domestic guinea pig(101787992) brain-enriched guanylate kinase-associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_354696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020836 Rosetta Predictions human pricing
NM_001111115 Rosetta Predictions rat pricing
NM_024163 Rosetta Predictions rat pricing
XM_354696 Rosetta Predictions mouse pricing
XM_914385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133449 predicted 233
2 SASI_Hs01_00133450 predicted 738
3 SASI_Hs01_00133451 predicted 229
4 SASI_Hs01_00133452 predicted 2350
5 SASI_Hs01_00133453 predicted 2340
6 SASI_Hs01_00133454 predicted 2064
7 SASI_Hs01_00133455 predicted 741
8 SASI_Hs01_00133456 predicted 2151
9 SASI_Hs01_00133457 predicted 253
10 SASI_Hs01_00133458 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111115 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251502 predicted 2365
2 SASI_Rn02_00251503 predicted 421
3 SASI_Rn02_00251504 predicted 754
4 SASI_Rn02_00251505 predicted 1503
5 SASI_Rn02_00251506 predicted 450
6 SASI_Rn02_00251507 predicted 768
7 SASI_Rn02_00251508 predicted 796
8 SASI_Rn02_00251509 predicted 1622
9 SASI_Rn02_00251510 predicted 1739
10 SASI_Rn02_00251511 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100142 predicted 2380
2 SASI_Rn01_00100143 predicted 444
3 SASI_Rn01_00100144 predicted 773
4 SASI_Rn01_00100145 predicted 1526
5 SASI_Rn02_00263898 predicted 470
6 SASI_Rn01_00100147 predicted 788
7 SASI_Rn01_00100148 predicted 811
8 SASI_Rn01_00100150 predicted 1649
9 SASI_Rn01_00100151 predicted 1761
10 SASI_Rn02_00263899 predicted 1273
11 SASI_Rn01_00100146 predicted 1736
12 SASI_Rn01_00100149 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213435 predicted 2373
2 SASI_Mm01_00213436 predicted 266
3 SASI_Mm01_00213437 predicted 2205
4 SASI_Mm01_00213439 predicted 1857
5 SASI_Mm01_00213441 predicted 1770
6 SASI_Mm01_00213443 predicted 762
7 SASI_Mm01_00213444 predicted 2261
8 SASI_Mm02_00425751 predicted 459
9 SASI_Mm02_00425752 predicted 1853
10 SASI_Mm02_00425753 predicted 1902
11 SASI_Mm01_00213438 predicted 278
12 SASI_Mm01_00213440 predicted 2434
13 SASI_Mm01_00213442 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438497 predicted 2388
2 SASI_Mm02_00438498 predicted 260
3 SASI_Mm02_00438499 predicted 2218
4 SASI_Mm02_00438500 predicted 1873
5 SASI_Mm02_00438501 predicted 1783
6 SASI_Mm02_00438502 predicted 762
7 SASI_Mm02_00438503 predicted 2273
8 SASI_Mm02_00438504 predicted 453
9 SASI_Mm02_00438505 predicted 1868
10 SASI_Mm02_00438506 predicted 1922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354696
BEGAIN MISSION shRNA Bacterial Glycerol Stock
brain-enriched guanylate kinase-associated
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_354696.3-2264s1c1
Sequence:CCGGCCCACATGAAGGTCCTTCATTCTCGAGAATGAAGGACCTTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1097s1c1
Sequence:CCGGCGACGAGTTCTTCAACCGCAACTCGAGTTGCGGTTGAAGAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1859s1c1
Sequence:CCGGCCGTAAGGACAGTCTCACTAACTCGAGTTAGTGAGACTGTCCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-255s1c1
Sequence:CCGGCTAGACAAGGTGACGGAGAAACTCGAGTTTCTCCGTCACCTTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1433s1c1
Sequence:CCGGCTGCAACTACTCGGAACGTTACTCGAGTAACGTTCCGAGTAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354696
BEGAIN MISSION shRNA shRNA Plasmid DNA
brain-enriched guanylate kinase-associated
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_354696.3-2264s1c1
Sequence:CCGGCCCACATGAAGGTCCTTCATTCTCGAGAATGAAGGACCTTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1097s1c1
Sequence:CCGGCGACGAGTTCTTCAACCGCAACTCGAGTTGCGGTTGAAGAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1859s1c1
Sequence:CCGGCCGTAAGGACAGTCTCACTAACTCGAGTTAGTGAGACTGTCCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-255s1c1
Sequence:CCGGCTAGACAAGGTGACGGAGAAACTCGAGTTTCTCCGTCACCTTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1433s1c1
Sequence:CCGGCTGCAACTACTCGGAACGTTACTCGAGTAACGTTCCGAGTAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354696
BEGAIN MISSION shRNA Lentiviral Transduction Particles
brain-enriched guanylate kinase-associated
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088553    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_354696.3-2264s1c1
Sequence:CCGGCCCACATGAAGGTCCTTCATTCTCGAGAATGAAGGACCTTCATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1097s1c1
Sequence:CCGGCGACGAGTTCTTCAACCGCAACTCGAGTTGCGGTTGAAGAACTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1859s1c1
Sequence:CCGGCCGTAAGGACAGTCTCACTAACTCGAGTTAGTGAGACTGTCCTTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-255s1c1
Sequence:CCGGCTAGACAAGGTGACGGAGAAACTCGAGTTTCTCCGTCACCTTGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354696.3-1433s1c1
Sequence:CCGGCTGCAACTACTCGGAACGTTACTCGAGTAACGTTCCGAGTAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020836
VALIDATED
BEGAIN MISSION shRNA Bacterial Glycerol Stock
brain-enriched guanylate kinase-associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020836.2-2570s1c1
Sequence:CCGGCCTCCATTCCTGGTTTCTGTACTCGAGTACAGAAACCAGGAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-246s1c1
Sequence:CCGGCAGGATTCAGAGCAACTACATCTCGAGATGTAGTTGCTCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-1830s1c1
Sequence:CCGGGCTCTACGGAACCTTGCTCAACTCGAGTTGAGCAAGGTTCCGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-1398s1c1
Sequence:CCGGCAGCTTCTCTGAACGCTACTACTCGAGTAGTAGCGTTCAGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020836.2-123s1c1
Sequence:CCGGGCTGTCCTACACCACACACAACTCGAGTTGTGTGTGGTGTAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-414s21c1
Sequence:CCGGAGAGGACAACGAGCTCTATAGCTCGAGCTATAGAGCTCGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020836.3-1835s21c1
Sequence:CCGGACGGAACCTTGCTCAACTGAGCTCGAGCTCAGTTGAGCAAGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020836.3-2157s21c1
Sequence:CCGGAGGGTCTTTCTTAACGCACTTCTCGAGAAGTGCGTTAAGAAAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-246s21c1
Sequence:CCGGCAGGATTCAGAGCAACTACATCTCGAGATGTAGTTGCTCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-1398s21c1
Sequence:CCGGCAGCTTCTCTGAACGCTACTACTCGAGTAGTAGCGTTCAGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020836
VALIDATED
BEGAIN MISSION shRNA shRNA Plasmid DNA
brain-enriched guanylate kinase-associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020836.2-2570s1c1
Sequence:CCGGCCTCCATTCCTGGTTTCTGTACTCGAGTACAGAAACCAGGAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-246s1c1
Sequence:CCGGCAGGATTCAGAGCAACTACATCTCGAGATGTAGTTGCTCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-1830s1c1
Sequence:CCGGGCTCTACGGAACCTTGCTCAACTCGAGTTGAGCAAGGTTCCGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-1398s1c1
Sequence:CCGGCAGCTTCTCTGAACGCTACTACTCGAGTAGTAGCGTTCAGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020836.2-123s1c1
Sequence:CCGGGCTGTCCTACACCACACACAACTCGAGTTGTGTGTGGTGTAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-414s21c1
Sequence:CCGGAGAGGACAACGAGCTCTATAGCTCGAGCTATAGAGCTCGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020836.3-1835s21c1
Sequence:CCGGACGGAACCTTGCTCAACTGAGCTCGAGCTCAGTTGAGCAAGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020836.3-2157s21c1
Sequence:CCGGAGGGTCTTTCTTAACGCACTTCTCGAGAAGTGCGTTAAGAAAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-246s21c1
Sequence:CCGGCAGGATTCAGAGCAACTACATCTCGAGATGTAGTTGCTCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-1398s21c1
Sequence:CCGGCAGCTTCTCTGAACGCTACTACTCGAGTAGTAGCGTTCAGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020836
VALIDATED
BEGAIN MISSION shRNA Lentiviral Transduction Particles
brain-enriched guanylate kinase-associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020836.2-2570s1c1
Sequence:CCGGCCTCCATTCCTGGTTTCTGTACTCGAGTACAGAAACCAGGAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-246s1c1
Sequence:CCGGCAGGATTCAGAGCAACTACATCTCGAGATGTAGTTGCTCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-1830s1c1
Sequence:CCGGGCTCTACGGAACCTTGCTCAACTCGAGTTGAGCAAGGTTCCGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020836.2-1398s1c1
Sequence:CCGGCAGCTTCTCTGAACGCTACTACTCGAGTAGTAGCGTTCAGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020836.2-123s1c1
Sequence:CCGGGCTGTCCTACACCACACACAACTCGAGTTGTGTGTGGTGTAGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-414s21c1
Sequence:CCGGAGAGGACAACGAGCTCTATAGCTCGAGCTATAGAGCTCGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_020836.3-1835s21c1
Sequence:CCGGACGGAACCTTGCTCAACTGAGCTCGAGCTCAGTTGAGCAAGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_020836.3-2157s21c1
Sequence:CCGGAGGGTCTTTCTTAACGCACTTCTCGAGAAGTGCGTTAAGAAAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-246s21c1
Sequence:CCGGCAGGATTCAGAGCAACTACATCTCGAGATGTAGTTGCTCTGAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020836.3-1398s21c1
Sequence:CCGGCAGCTTCTCTGAACGCTACTACTCGAGTAGTAGCGTTCAGAGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163175
BEGAIN MISSION shRNA Bacterial Glycerol Stock
brain-enriched guanylate kinase-associated
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-1860s21c1
Sequence:CCGGCGTAAGGACAGTCTCACTAAACTCGAGTTTAGTGAGACTGTCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-448s21c1
Sequence:CCGGCGGAGGACAACGAGCTCTATACTCGAGTATAGAGCTCGTTGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-256s21c1
Sequence:CCGGTAGACAAGGTGACGGAGAAACCTCGAGGTTTCTCCGTCACCTTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-158s21c1
Sequence:CCGGGCTCTCCTACACCACGCATAACTCGAGTTATGCGTGGTGTAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163175
BEGAIN MISSION shRNA shRNA Plasmid DNA
brain-enriched guanylate kinase-associated
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-1860s21c1
Sequence:CCGGCGTAAGGACAGTCTCACTAAACTCGAGTTTAGTGAGACTGTCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-448s21c1
Sequence:CCGGCGGAGGACAACGAGCTCTATACTCGAGTATAGAGCTCGTTGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-256s21c1
Sequence:CCGGTAGACAAGGTGACGGAGAAACCTCGAGGTTTCTCCGTCACCTTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-158s21c1
Sequence:CCGGGCTCTCCTACACCACGCATAACTCGAGTTATGCGTGGTGTAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163175
BEGAIN MISSION shRNA Lentiviral Transduction Particles
brain-enriched guanylate kinase-associated
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-1860s21c1
Sequence:CCGGCGTAAGGACAGTCTCACTAAACTCGAGTTTAGTGAGACTGTCCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-448s21c1
Sequence:CCGGCGGAGGACAACGAGCTCTATACTCGAGTATAGAGCTCGTTGTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-256s21c1
Sequence:CCGGTAGACAAGGTGACGGAGAAACCTCGAGGTTTCTCCGTCACCTTGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163175.1-158s21c1
Sequence:CCGGGCTCTCCTACACCACGCATAACTCGAGTTATGCGTGGTGTAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks