EMAIL THIS PAGE TO A FRIEND

BEND2

BEN domain containing 2

Synonyms: CXorf20
UniProtKB ID: Q8NDZ0, E9PFY2, Q4V9S2, Q5JXE5
Gene ID:
Human(139105) Summary: This gene encodes a protein which has two BEN domains in the C-terminus. These domains are found in proteins which participate in protein and DNA interactions which occur during chromatin restructuring or transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
chicken(772331) BEN domain containing 2
cow(101905742) BEN domain containing 2
cow(100140251) BEN domain containing 2
sheep(101103875) BEN domain containing 2
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153346 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144171 MISSION® esiRNA esiRNA human BEND2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153346 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087868 predicted 1369
2 SASI_Hs01_00087869 predicted 1420
3 SASI_Hs02_00367204 predicted 2193
4 SASI_Hs02_00367205 predicted 1478
5 SASI_Hs01_00087871 predicted 1332
6 SASI_Hs01_00087872 predicted 1598
7 SASI_Hs01_00087873 predicted 1240
8 SASI_Hs01_00087874 predicted 2019
9 SASI_Hs01_00087875 predicted 954
10 SASI_Hs01_00087876 predicted 1834
11 SASI_Hs01_00087870 predicted 1793
12 SASI_Hs01_00087877 predicted 1762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153346
BEND2 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153346.2-4076s1c1
Sequence:CCGGCGTATGGCTATTGAGCATTTACTCGAGTAAATGCTCAATAGCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1032s1c1
Sequence:CCGGCCCAATTTGGAAATGCCAGAACTCGAGTTCTGGCATTTCCAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-733s1c1
Sequence:CCGGCAGACCTCAGTGAGAGTTTATCTCGAGATAAACTCTCACTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1650s1c1
Sequence:CCGGGCCTGCTACTTGGTTCGTATTCTCGAGAATACGAACCAAGTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153346.2-1076s1c1
Sequence:CCGGCAGCACTGAGACAGCGAATTACTCGAGTAATTCGCTGTCTCAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1519s1c1
Sequence:CCGGGCCAGGATTCTTCCTCATCATCTCGAGATGATGAGGAAGAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1491s1c1
Sequence:CCGGCGCTCAACTTTATTGGACAGTCTCGAGACTGTCCAATAAAGTTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153346
BEND2 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153346.2-4076s1c1
Sequence:CCGGCGTATGGCTATTGAGCATTTACTCGAGTAAATGCTCAATAGCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1032s1c1
Sequence:CCGGCCCAATTTGGAAATGCCAGAACTCGAGTTCTGGCATTTCCAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-733s1c1
Sequence:CCGGCAGACCTCAGTGAGAGTTTATCTCGAGATAAACTCTCACTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1650s1c1
Sequence:CCGGGCCTGCTACTTGGTTCGTATTCTCGAGAATACGAACCAAGTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153346.2-1076s1c1
Sequence:CCGGCAGCACTGAGACAGCGAATTACTCGAGTAATTCGCTGTCTCAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1519s1c1
Sequence:CCGGGCCAGGATTCTTCCTCATCATCTCGAGATGATGAGGAAGAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1491s1c1
Sequence:CCGGCGCTCAACTTTATTGGACAGTCTCGAGACTGTCCAATAAAGTTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153346
BEND2 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153346.2-4076s1c1
Sequence:CCGGCGTATGGCTATTGAGCATTTACTCGAGTAAATGCTCAATAGCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1032s1c1
Sequence:CCGGCCCAATTTGGAAATGCCAGAACTCGAGTTCTGGCATTTCCAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-733s1c1
Sequence:CCGGCAGACCTCAGTGAGAGTTTATCTCGAGATAAACTCTCACTGAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1650s1c1
Sequence:CCGGGCCTGCTACTTGGTTCGTATTCTCGAGAATACGAACCAAGTAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139805    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153346.2-1076s1c1
Sequence:CCGGCAGCACTGAGACAGCGAATTACTCGAGTAATTCGCTGTCTCAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1519s1c1
Sequence:CCGGGCCAGGATTCTTCCTCATCATCTCGAGATGATGAGGAAGAATCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153346.2-1491s1c1
Sequence:CCGGCGCTCAACTTTATTGGACAGTCTCGAGACTGTCCAATAAAGTTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks