EMAIL THIS PAGE TO A FRIEND

BEND3

BEN domain containing 3

51 Gene Product Result for
Synonyms: KIAA1553 RP11-59I9.2
UniProtKB ID: Q5T5X7, A2RRH2, Q9HCL9
Gene ID:
Mouse(331623) BEN domain containing 3
Rat(683923) BEN domain containing 3
sheep(101119224) BEN domain containing 3
Domestic Rabbit(100341272) BEN domain containing 3
naked mole-rat(101697525) BEN domain containing 3
domestic guinea pig(100735724) BEN domain containing 3
Zebrafish(565716) BEN domain containing 3
cow(525371) BEN domain containing 3
Horse(100066484) BEN domain containing 3
domestic cat(101096894) BEN domain containing 3
dog(481949) BEN domain containing 3
chicken(421778) BEN domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080450 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080450 Rosetta Predictions human pricing
XM_166320 Rosetta Predictions human pricing
XM_001068075 Rosetta Predictions rat pricing
NM_199028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314956 predicted 1591
2 SASI_Hs02_00314957 predicted 2340
3 SASI_Hs02_00314958 predicted 657
4 SASI_Hs02_00314959 predicted 1481
5 SASI_Hs02_00314960 predicted 1363
6 SASI_Hs02_00314961 predicted 2445
7 SASI_Hs02_00314962 predicted 1359
8 SASI_Hs02_00314963 predicted 495
9 SASI_Hs02_00314964 predicted 1514
10 SASI_Hs02_00314965 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249857 predicted 2140
2 SASI_Hs01_00249858 predicted 1507
3 SASI_Hs01_00249859 predicted 2306
4 SASI_Hs01_00249860 predicted 1060
5 SASI_Hs01_00249861 predicted 216
6 SASI_Hs01_00249862 predicted 1824
7 SASI_Hs01_00249863 predicted 2609
8 SASI_Hs01_00249864 predicted 182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323344 predicted 2382
2 SASI_Rn02_00323345 predicted 208
3 SASI_Rn02_00323346 predicted 1337
4 SASI_Rn02_00323347 predicted 1351
5 SASI_Rn02_00323348 predicted 563
6 SASI_Rn02_00323349 predicted 1343
7 SASI_Rn02_00323350 predicted 2230
8 SASI_Rn02_00323351 predicted 912
9 SASI_Rn02_00323352 predicted 2064
10 SASI_Rn02_00323353 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351291 predicted 1154
2 SASI_Mm02_00351292 predicted 1576
3 SASI_Mm02_00351293 predicted 2394
4 SASI_Mm02_00351294 predicted 619
5 SASI_Mm02_00351295 predicted 1591
6 SASI_Mm02_00351296 predicted 1592
7 SASI_Mm02_00351297 predicted 835
8 SASI_Mm02_00351298 predicted 1582
9 SASI_Mm02_00351299 predicted 848
10 SASI_Mm02_00351300 predicted 1300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199028
VALIDATED
BEND3 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-2242s1c1
Sequence:CCGGCCTAGCAAGTTACGCAATCAACTCGAGTTGATTGCGTAACTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-4202s1c1
Sequence:CCGGCGTGATAACTTTAATGGCTTACTCGAGTAAGCCATTAAAGTTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-844s1c1
Sequence:CCGGCAATGGACTCACGACTAATATCTCGAGATATTAGTCGTGAGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-820s1c1
Sequence:CCGGGATCCAGAAGATGTTCTACATCTCGAGATGTAGAACATCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199028.1-2629s1c1
Sequence:CCGGCTATGAATGTATACCTAGCATCTCGAGATGCTAGGTATACATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-755s21c1
Sequence:CCGGGAGTCTCAGAAGCGGGAATGTCTCGAGACATTCCCGCTTCTGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1750s21c1
Sequence:CCGGAGACGACATCTCGGTGGTCAACTCGAGTTGACCACCGAGATGTCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-2004s21c1
Sequence:CCGGACCTGCGCAAGCAGTACAACTCTCGAGAGTTGTACTGCTTGCGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1234s21c1
Sequence:CCGGTGACTTCTTCAGCCGCTTCTGCTCGAGCAGAAGCGGCTGAAGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1591s21c1
Sequence:CCGGCAACTACACAGAGATCTACTTCTCGAGAAGTAGATCTCTGTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199028
VALIDATED
BEND3 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-2242s1c1
Sequence:CCGGCCTAGCAAGTTACGCAATCAACTCGAGTTGATTGCGTAACTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-4202s1c1
Sequence:CCGGCGTGATAACTTTAATGGCTTACTCGAGTAAGCCATTAAAGTTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-844s1c1
Sequence:CCGGCAATGGACTCACGACTAATATCTCGAGATATTAGTCGTGAGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-820s1c1
Sequence:CCGGGATCCAGAAGATGTTCTACATCTCGAGATGTAGAACATCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199028.1-2629s1c1
Sequence:CCGGCTATGAATGTATACCTAGCATCTCGAGATGCTAGGTATACATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-755s21c1
Sequence:CCGGGAGTCTCAGAAGCGGGAATGTCTCGAGACATTCCCGCTTCTGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1750s21c1
Sequence:CCGGAGACGACATCTCGGTGGTCAACTCGAGTTGACCACCGAGATGTCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-2004s21c1
Sequence:CCGGACCTGCGCAAGCAGTACAACTCTCGAGAGTTGTACTGCTTGCGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1234s21c1
Sequence:CCGGTGACTTCTTCAGCCGCTTCTGCTCGAGCAGAAGCGGCTGAAGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1591s21c1
Sequence:CCGGCAACTACACAGAGATCTACTTCTCGAGAAGTAGATCTCTGTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199028
VALIDATED
BEND3 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-2242s1c1
Sequence:CCGGCCTAGCAAGTTACGCAATCAACTCGAGTTGATTGCGTAACTTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197685    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-4202s1c1
Sequence:CCGGCGTGATAACTTTAATGGCTTACTCGAGTAAGCCATTAAAGTTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-844s1c1
Sequence:CCGGCAATGGACTCACGACTAATATCTCGAGATATTAGTCGTGAGTCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199028.1-820s1c1
Sequence:CCGGGATCCAGAAGATGTTCTACATCTCGAGATGTAGAACATCTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199028.1-2629s1c1
Sequence:CCGGCTATGAATGTATACCTAGCATCTCGAGATGCTAGGTATACATTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-755s21c1
Sequence:CCGGGAGTCTCAGAAGCGGGAATGTCTCGAGACATTCCCGCTTCTGAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1750s21c1
Sequence:CCGGAGACGACATCTCGGTGGTCAACTCGAGTTGACCACCGAGATGTCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-2004s21c1
Sequence:CCGGACCTGCGCAAGCAGTACAACTCTCGAGAGTTGTACTGCTTGCGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1234s21c1
Sequence:CCGGTGACTTCTTCAGCCGCTTCTGCTCGAGCAGAAGCGGCTGAAGAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199028.2-1591s21c1
Sequence:CCGGCAACTACACAGAGATCTACTTCTCGAGAAGTAGATCTCTGTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080450
VALIDATED
BEND3 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-377s21c1
Sequence:CCGGCCTACAAGAAGCCTCTGTATGCTCGAGCATACAGAGGCTTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-449s21c1
Sequence:CCGGTAAACGTGTACGAGCTCTTTGCTCGAGCAAAGAGCTCGTACACGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080450.1-911s21c1
Sequence:CCGGTGCAGCTCATCCGCAACTATGCTCGAGCATAGTTGCGGATGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080450.1-4040s21c1
Sequence:CCGGCCAGTGGCTGTATGACATAATCTCGAGATTATGTCATACAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-1598s21c1
Sequence:CCGGCCATCGACTTCGACAAGTTAGCTCGAGCTAACTTGTCGAAGTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080450
VALIDATED
BEND3 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-377s21c1
Sequence:CCGGCCTACAAGAAGCCTCTGTATGCTCGAGCATACAGAGGCTTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-449s21c1
Sequence:CCGGTAAACGTGTACGAGCTCTTTGCTCGAGCAAAGAGCTCGTACACGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080450.1-911s21c1
Sequence:CCGGTGCAGCTCATCCGCAACTATGCTCGAGCATAGTTGCGGATGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080450.1-4040s21c1
Sequence:CCGGCCAGTGGCTGTATGACATAATCTCGAGATTATGTCATACAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-1598s21c1
Sequence:CCGGCCATCGACTTCGACAAGTTAGCTCGAGCTAACTTGTCGAAGTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080450
VALIDATED
BEND3 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-377s21c1
Sequence:CCGGCCTACAAGAAGCCTCTGTATGCTCGAGCATACAGAGGCTTCTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-449s21c1
Sequence:CCGGTAAACGTGTACGAGCTCTTTGCTCGAGCAAAGAGCTCGTACACGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080450.1-911s21c1
Sequence:CCGGTGCAGCTCATCCGCAACTATGCTCGAGCATAGTTGCGGATGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080450.1-4040s21c1
Sequence:CCGGCCAGTGGCTGTATGACATAATCTCGAGATTATGTCATACAGCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080450.1-1598s21c1
Sequence:CCGGCCATCGACTTCGACAAGTTAGCTCGAGCTAACTTGTCGAAGTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks