EMAIL THIS PAGE TO A FRIEND

BEND4

BEN domain containing 4

219 Gene Product Result for
Synonyms: CCDC4
UniProtKB ID: Q6ZU67, A1A5D6, A1A5D7, C9JQZ5, Q58A26, Q58A27
Gene ID:
Mouse(666938) BEN domain containing 4
Rat(681008) BEN domain containing 4
chicken(422777) BEN domain containing 4
cow(614525) BEN domain containing 4
Horse(100063015) BEN domain containing 4
domestic cat(101092606) BEN domain containing 4
dog(482119) BEN domain containing 4
domestic guinea pig(100716736) BEN domain containing 4
naked mole-rat(101697479) BEN domain containing 4
sheep(101111023) BEN domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207406 Rosetta Predictions human pricing
XM_001059897 Rosetta Predictions rat pricing
XM_001477289 Rosetta Predictions mouse pricing
XR_001946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374018 predicted 2455
2 SASI_Hs02_00374019 predicted 1745
3 SASI_Hs02_00374020 predicted 1764
4 SASI_Hs01_00139238 predicted 1752
5 SASI_Hs02_00374021 predicted 2427
6 SASI_Hs02_00374022 predicted 2189
7 SASI_Hs01_00139242 predicted 1255
8 SASI_Hs02_00374023 predicted 1918
9 SASI_Hs02_00374024 predicted 2268
10 SASI_Hs02_00374025 predicted 2302
11 SASI_Hs01_00139234 predicted 1382
12 SASI_Hs01_00139235 predicted 1040
13 SASI_Hs01_00139236 predicted 1366
14 SASI_Hs01_00139237 predicted 428
15 SASI_Hs01_00139239 predicted 1357
16 SASI_Hs01_00139240 predicted 1157
17 SASI_Hs01_00139241 predicted 1323
18 SASI_Hs01_00139243 predicted 1346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294756 predicted 1738
2 SASI_Rn02_00294757 predicted 1667
3 SASI_Rn02_00294758 predicted 1545
4 SASI_Rn02_00294759 predicted 1049
5 SASI_Rn02_00294760 predicted 1056
6 SASI_Rn02_00294761 predicted 1554
7 SASI_Rn02_00294762 predicted 1723
8 SASI_Rn02_00294763 predicted 1721
9 SASI_Rn02_00294764 predicted 1070
10 SASI_Rn02_00294765 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00394814 predicted 1990
2 SASI_Mm02_00394815 predicted 1917
3 SASI_Mm02_00394816 predicted 1898
4 SASI_Mm02_00394817 predicted 1307
5 SASI_Mm02_00394818 predicted 1426
6 SASI_Mm02_00394819 predicted 1973
7 SASI_Mm02_00394820 predicted 1320
8 SASI_Mm02_00394821 predicted 1893
9 SASI_Mm02_00394822 predicted 1326
10 SASI_Mm02_00394823 predicted 1873
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_001946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233066 predicted 1985
2 SASI_Mm01_00233067 predicted 1925
3 SASI_Mm01_00233068 predicted 1909
4 SASI_Mm01_00233069 predicted 2089
5 SASI_Mm01_00233070 predicted 2090
6 SASI_Mm01_00233071 predicted 1311
7 SASI_Mm01_00233072 predicted 2034
8 SASI_Mm01_00233073 predicted 1972
9 SASI_Mm01_00233074 predicted 1321
10 SASI_Mm01_00233075 predicted 1897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207406
VALIDATED
BEND4 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1823s21c1
Sequence:CCGGCTTCGATACCTCATCAGATTTCTCGAGAAATCTGATGAGGTATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1563s21c1
Sequence:CCGGAGCTGGAGCAGGAGGTTATTTCTCGAGAAATAACCTCCTGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-3479s21c1
Sequence:CCGGGCTAAATGGACAGCGTTTATTCTCGAGAATAAACGCTGTCCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1165s21c1
Sequence:CCGGGTCCATGATTTCTTGCGTAAACTCGAGTTTACGCAAGAAATCATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207406.1-259s1c1
Sequence:CCGGCGAATGATCTTGGATGCCTTTCTCGAGAAAGGCATCCAAGATCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207406.1-349s1c1
Sequence:CCGGCAGTCCATGATTTCTTGCGTACTCGAGTACGCAAGAAATCATGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207406.1-2020s1c1
Sequence:CCGGCCCTAGTTATTGGAAAGAATACTCGAGTATTCTTTCCAATAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207406
VALIDATED
BEND4 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1823s21c1
Sequence:CCGGCTTCGATACCTCATCAGATTTCTCGAGAAATCTGATGAGGTATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1563s21c1
Sequence:CCGGAGCTGGAGCAGGAGGTTATTTCTCGAGAAATAACCTCCTGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-3479s21c1
Sequence:CCGGGCTAAATGGACAGCGTTTATTCTCGAGAATAAACGCTGTCCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1165s21c1
Sequence:CCGGGTCCATGATTTCTTGCGTAAACTCGAGTTTACGCAAGAAATCATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207406.1-259s1c1
Sequence:CCGGCGAATGATCTTGGATGCCTTTCTCGAGAAAGGCATCCAAGATCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207406.1-349s1c1
Sequence:CCGGCAGTCCATGATTTCTTGCGTACTCGAGTACGCAAGAAATCATGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207406.1-2020s1c1
Sequence:CCGGCCCTAGTTATTGGAAAGAATACTCGAGTATTCTTTCCAATAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207406
VALIDATED
BEND4 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1823s21c1
Sequence:CCGGCTTCGATACCTCATCAGATTTCTCGAGAAATCTGATGAGGTATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1563s21c1
Sequence:CCGGAGCTGGAGCAGGAGGTTATTTCTCGAGAAATAACCTCCTGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-3479s21c1
Sequence:CCGGGCTAAATGGACAGCGTTTATTCTCGAGAATAAACGCTGTCCATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_207406.2-1165s21c1
Sequence:CCGGGTCCATGATTTCTTGCGTAAACTCGAGTTTACGCAAGAAATCATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207406.1-259s1c1
Sequence:CCGGCGAATGATCTTGGATGCCTTTCTCGAGAAAGGCATCCAAGATCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207406.1-349s1c1
Sequence:CCGGCAGTCCATGATTTCTTGCGTACTCGAGTACGCAAGAAATCATGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167169    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207406.1-2020s1c1
Sequence:CCGGCCCTAGTTATTGGAAAGAATACTCGAGTATTCTTTCCAATAACTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks