EMAIL THIS PAGE TO A FRIEND

BEND5

BEN domain containing 5

56 Gene Product Result for
Synonyms: C1orf165
UniProtKB ID: Q7L4P6, D3DQ27, Q96A62, Q9HAI3
Gene ID:
Mouse(67621) BEN domain containing 5
Rat(362564) BEN domain containing 5
sheep(101107646) BEN domain containing 5
Domestic Rabbit(100338497) BEN domain containing 5
naked mole-rat(101696735) BEN domain containing 5
domestic guinea pig(100719659) BEN domain containing 5
Zebrafish(566161) BEN domain containing 5
chicken(424628) BEN domain containing 5
dog(475363) BEN domain containing 5
domestic cat(101099137) BEN domain containing 5
cow(535329) BEN domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024603 Rosetta Predictions human pricing
NM_001108672 Rosetta Predictions rat pricing
NM_026279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053258 predicted 841
2 SASI_Hs02_00356958 predicted 539
3 SASI_Hs02_00356959 predicted 835
4 SASI_Hs02_00356960 predicted 493
5 SASI_Hs02_00356961 predicted 548
6 SASI_Hs02_00356962 predicted 544
7 SASI_Hs02_00356963 predicted 863
8 SASI_Hs02_00356964 predicted 823
9 SASI_Hs02_00356965 predicted 845
10 SASI_Hs02_00356966 predicted 491
11 SASI_Hs01_00053259 predicted 826
12 SASI_Hs01_00053260 predicted 826
13 SASI_Hs01_00053261 predicted 887
14 SASI_Hs01_00053262 predicted 745
15 SASI_Hs01_00053263 predicted 825
16 SASI_Hs01_00053264 predicted 698
17 SASI_Hs01_00053265 predicted 881
18 SASI_Hs01_00053266 predicted 876
19 SASI_Hs01_00053267 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240935 predicted 874
2 SASI_Rn02_00240936 predicted 665
3 SASI_Rn02_00240937 predicted 1557
4 SASI_Rn02_00240938 predicted 1571
5 SASI_Rn02_00240939 predicted 960
6 SASI_Rn02_00240940 predicted 1467
7 SASI_Rn02_00240941 predicted 1494
8 SASI_Rn02_00240942 predicted 499
9 SASI_Rn02_00240943 predicted 399
10 SASI_Rn02_00240944 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041624 predicted 960
2 SASI_Mm01_00041625 predicted 668
3 SASI_Mm01_00041626 predicted 868
4 SASI_Mm01_00041627 predicted 961
5 SASI_Mm01_00041628 predicted 503
6 SASI_Mm01_00041629 predicted 720
7 SASI_Mm01_00041630 predicted 402
8 SASI_Mm01_00041631 predicted 496
9 SASI_Mm01_00041632 predicted 826
10 SASI_Mm01_00041633 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024603
BEND5 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-883s1c1
Sequence:CCGGGTTACGGAGCACTTTCAGTGACTCGAGTCACTGAAAGTGCTCCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-962s1c1
Sequence:CCGGCTAGACAATGGCAAGGTCCATCTCGAGATGGACCTTGCCATTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1188s1c1
Sequence:CCGGGAGAGTGTTTGTATGACAGAACTCGAGTTCTGTCATACAAACACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1179s1c1
Sequence:CCGGGCATCGTCAGAGAGTGTTTGTCTCGAGACAAACACTCTCTGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1169s1c1
Sequence:CCGGCGCAAACTAAGCATCGTCAGACTCGAGTCTGACGATGCTTAGTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-900s21c1
Sequence:CCGGGCGCCTGTCATGGACAAGTATCTCGAGATACTTGTCCATGACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-869s21c1
Sequence:CCGGAGCAAATACGTCGTCCTATTACTCGAGTAATAGGACGACGTATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-1016s21c1
Sequence:CCGGCACGAAGAACTTGGCAGTTATCTCGAGATAACTGCCAAGTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-1096s21c1
Sequence:CCGGAGAAAGATGCAGTCCCTAAACCTCGAGGTTTAGGGACTGCATCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024603
BEND5 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-883s1c1
Sequence:CCGGGTTACGGAGCACTTTCAGTGACTCGAGTCACTGAAAGTGCTCCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-962s1c1
Sequence:CCGGCTAGACAATGGCAAGGTCCATCTCGAGATGGACCTTGCCATTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1188s1c1
Sequence:CCGGGAGAGTGTTTGTATGACAGAACTCGAGTTCTGTCATACAAACACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1179s1c1
Sequence:CCGGGCATCGTCAGAGAGTGTTTGTCTCGAGACAAACACTCTCTGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1169s1c1
Sequence:CCGGCGCAAACTAAGCATCGTCAGACTCGAGTCTGACGATGCTTAGTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-900s21c1
Sequence:CCGGGCGCCTGTCATGGACAAGTATCTCGAGATACTTGTCCATGACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-869s21c1
Sequence:CCGGAGCAAATACGTCGTCCTATTACTCGAGTAATAGGACGACGTATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-1016s21c1
Sequence:CCGGCACGAAGAACTTGGCAGTTATCTCGAGATAACTGCCAAGTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-1096s21c1
Sequence:CCGGAGAAAGATGCAGTCCCTAAACCTCGAGGTTTAGGGACTGCATCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024603
BEND5 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-883s1c1
Sequence:CCGGGTTACGGAGCACTTTCAGTGACTCGAGTCACTGAAAGTGCTCCGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-962s1c1
Sequence:CCGGCTAGACAATGGCAAGGTCCATCTCGAGATGGACCTTGCCATTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1188s1c1
Sequence:CCGGGAGAGTGTTTGTATGACAGAACTCGAGTTCTGTCATACAAACACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1179s1c1
Sequence:CCGGGCATCGTCAGAGAGTGTTTGTCTCGAGACAAACACTCTCTGACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024603.1-1169s1c1
Sequence:CCGGCGCAAACTAAGCATCGTCAGACTCGAGTCTGACGATGCTTAGTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-900s21c1
Sequence:CCGGGCGCCTGTCATGGACAAGTATCTCGAGATACTTGTCCATGACAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-869s21c1
Sequence:CCGGAGCAAATACGTCGTCCTATTACTCGAGTAATAGGACGACGTATTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-1016s21c1
Sequence:CCGGCACGAAGAACTTGGCAGTTATCTCGAGATAACTGCCAAGTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024603.2-1096s21c1
Sequence:CCGGAGAAAGATGCAGTCCCTAAACCTCGAGGTTTAGGGACTGCATCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026279
BEND5 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-446s1c1
Sequence:CCGGCCCAAACTTTCTCTCAGTCATCTCGAGATGACTGAGAGAAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-731s1c1
Sequence:CCGGCGAAACTACCAGCAGCAACAACTCGAGTTGTTGCTGCTGGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-992s1c1
Sequence:CCGGGAAGCAAATACGTCGTCCTATCTCGAGATAGGACGACGTATTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-978s1c1
Sequence:CCGGGCACTTTCAGTGAGGAAGCAACTCGAGTTGCTTCCTCACTGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-1112s1c1
Sequence:CCGGCTACAAGTTACCCAAGGAGATCTCGAGATCTCCTTGGGTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026279.1-415s1c1
Sequence:CCGGGAACAGTGTGATGCAGAAGAACTCGAGTTCTTCTGCATCACACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026279.2-1267s1c1
Sequence:CCGGCATCGTCAGAGAGTGTTTATACTCGAGTATAAACACTCTCTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026279
BEND5 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-446s1c1
Sequence:CCGGCCCAAACTTTCTCTCAGTCATCTCGAGATGACTGAGAGAAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-731s1c1
Sequence:CCGGCGAAACTACCAGCAGCAACAACTCGAGTTGTTGCTGCTGGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-992s1c1
Sequence:CCGGGAAGCAAATACGTCGTCCTATCTCGAGATAGGACGACGTATTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-978s1c1
Sequence:CCGGGCACTTTCAGTGAGGAAGCAACTCGAGTTGCTTCCTCACTGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-1112s1c1
Sequence:CCGGCTACAAGTTACCCAAGGAGATCTCGAGATCTCCTTGGGTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026279.1-415s1c1
Sequence:CCGGGAACAGTGTGATGCAGAAGAACTCGAGTTCTTCTGCATCACACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026279.2-1267s1c1
Sequence:CCGGCATCGTCAGAGAGTGTTTATACTCGAGTATAAACACTCTCTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026279
BEND5 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-446s1c1
Sequence:CCGGCCCAAACTTTCTCTCAGTCATCTCGAGATGACTGAGAGAAAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-731s1c1
Sequence:CCGGCGAAACTACCAGCAGCAACAACTCGAGTTGTTGCTGCTGGTAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-992s1c1
Sequence:CCGGGAAGCAAATACGTCGTCCTATCTCGAGATAGGACGACGTATTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-978s1c1
Sequence:CCGGGCACTTTCAGTGAGGAAGCAACTCGAGTTGCTTCCTCACTGAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026279.1-1112s1c1
Sequence:CCGGCTACAAGTTACCCAAGGAGATCTCGAGATCTCCTTGGGTAACTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026279.1-415s1c1
Sequence:CCGGGAACAGTGTGATGCAGAAGAACTCGAGTTCTTCTGCATCACACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026279.2-1267s1c1
Sequence:CCGGCATCGTCAGAGAGTGTTTATACTCGAGTATAAACACTCTCTGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks