EMAIL THIS PAGE TO A FRIEND

BEND6

BEN domain containing 6

147 Gene Product Result for
Synonyms: C6orf65 bA203B9.1
UniProtKB ID: Q5SZJ8, Q4G0W8, Q8N662, Q96NS6
Gene ID:
Mouse(320705) BEN domain containing 6
Rat(363212) BEN domain containing 6
chicken(775985) BEN domain containing 6
dog(610495) BEN domain-containing protein 6-like
domestic cat(101098459) BEN domain containing 6
cow(504789) BEN domain containing 6
domestic guinea pig(100727553) BEN domain containing 6
naked mole-rat(101717410) BEN domain containing 6
sheep(101106552) BEN domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177235 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177235 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177235 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152731 Rosetta Predictions human pricing
NM_001108792 Rosetta Predictions rat pricing
NM_177235 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366643 predicted 1433
2 SASI_Hs01_00215147 predicted 1261
3 SASI_Hs02_00366644 predicted 1407
4 SASI_Hs01_00215148 predicted 602
5 SASI_Hs02_00366645 predicted 1020
6 SASI_Hs01_00215149 predicted 1238
7 SASI_Hs02_00366646 predicted 1180
8 SASI_Hs01_00215150 predicted 712
9 SASI_Hs01_00215151 predicted 983
10 SASI_Hs01_00215152 predicted 1317
11 SASI_Hs01_00215153 predicted 276
12 SASI_Hs01_00215154 predicted 918
13 SASI_Hs01_00215155 predicted 871
14 SASI_Hs01_00215156 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242115 predicted 833
2 SASI_Rn02_00242116 predicted 244
3 SASI_Rn02_00242117 predicted 686
4 SASI_Rn02_00242118 predicted 718
5 SASI_Rn02_00242119 predicted 881
6 SASI_Rn02_00242120 predicted 624
7 SASI_Rn02_00242121 predicted 757
8 SASI_Rn02_00242122 predicted 803
9 SASI_Rn02_00242123 predicted 277
10 SASI_Rn02_00242124 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177235 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136760 predicted 232
2 SASI_Mm02_00347267 predicted 920
3 SASI_Mm01_00136761 predicted 886
4 SASI_Mm01_00136762 predicted 825
5 SASI_Mm01_00136763 predicted 1011
6 SASI_Mm01_00136764 predicted 843
7 SASI_Mm01_00136765 predicted 233
8 SASI_Mm01_00136766 predicted 1051
9 SASI_Mm01_00136767 predicted 650
10 SASI_Mm01_00136768 predicted 269
11 SASI_Mm01_00136769 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177235
BEND6 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-681s1c1
Sequence:CCGGGCAGATTGCCCGTTGTAATAACTCGAGTTATTACAACGGGCAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177235.3-1661s1c1
Sequence:CCGGCAGATGTGTAATAGTAGATAACTCGAGTTATCTACTATTACACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-727s1c1
Sequence:CCGGGATTTAATGCAAGTACTTTACCTCGAGGTAAAGTACTTGCATTAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-414s1c1
Sequence:CCGGGCTTCGACAGTCTTTGGTCATCTCGAGATGACCAAAGACTGTCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-238s1c1
Sequence:CCGGGCGAATAGTGCTCTGGAGAAACTCGAGTTTCTCCAGAGCACTATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177235.3-1441s1c1
Sequence:CCGGCCGTTTGAGTTATTCTGTGATCTCGAGATCACAGAATAACTCAAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-807s1c1
Sequence:CCGGCAAGGTTGTCAAACCAGCTATCTCGAGATAGCTGGTTTGACAACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-176s1c1
Sequence:CCGGCCGACAACCAAGTTCTTAGAACTCGAGTTCTAAGAACTTGGTTGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-454s1c1
Sequence:CCGGGCAGTCACACAGTTTGAAGAACTCGAGTTCTTCAAACTGTGTGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177235
BEND6 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-681s1c1
Sequence:CCGGGCAGATTGCCCGTTGTAATAACTCGAGTTATTACAACGGGCAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177235.3-1661s1c1
Sequence:CCGGCAGATGTGTAATAGTAGATAACTCGAGTTATCTACTATTACACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-727s1c1
Sequence:CCGGGATTTAATGCAAGTACTTTACCTCGAGGTAAAGTACTTGCATTAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-414s1c1
Sequence:CCGGGCTTCGACAGTCTTTGGTCATCTCGAGATGACCAAAGACTGTCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-238s1c1
Sequence:CCGGGCGAATAGTGCTCTGGAGAAACTCGAGTTTCTCCAGAGCACTATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177235.3-1441s1c1
Sequence:CCGGCCGTTTGAGTTATTCTGTGATCTCGAGATCACAGAATAACTCAAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-807s1c1
Sequence:CCGGCAAGGTTGTCAAACCAGCTATCTCGAGATAGCTGGTTTGACAACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-176s1c1
Sequence:CCGGCCGACAACCAAGTTCTTAGAACTCGAGTTCTAAGAACTTGGTTGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-454s1c1
Sequence:CCGGGCAGTCACACAGTTTGAAGAACTCGAGTTCTTCAAACTGTGTGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177235
BEND6 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-681s1c1
Sequence:CCGGGCAGATTGCCCGTTGTAATAACTCGAGTTATTACAACGGGCAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215348    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177235.3-1661s1c1
Sequence:CCGGCAGATGTGTAATAGTAGATAACTCGAGTTATCTACTATTACACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-727s1c1
Sequence:CCGGGATTTAATGCAAGTACTTTACCTCGAGGTAAAGTACTTGCATTAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177235.3-414s1c1
Sequence:CCGGGCTTCGACAGTCTTTGGTCATCTCGAGATGACCAAAGACTGTCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-238s1c1
Sequence:CCGGGCGAATAGTGCTCTGGAGAAACTCGAGTTTCTCCAGAGCACTATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191291    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177235.3-1441s1c1
Sequence:CCGGCCGTTTGAGTTATTCTGTGATCTCGAGATCACAGAATAACTCAAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-807s1c1
Sequence:CCGGCAAGGTTGTCAAACCAGCTATCTCGAGATAGCTGGTTTGACAACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-176s1c1
Sequence:CCGGCCGACAACCAAGTTCTTAGAACTCGAGTTCTAAGAACTTGGTTGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177235.3-454s1c1
Sequence:CCGGGCAGTCACACAGTTTGAAGAACTCGAGTTCTTCAAACTGTGTGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152731
BEND6 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152731.1-545s1c1
Sequence:CCGGCGACAGTCTTTGGTCATGCTTCTCGAGAAGCATGACCAAAGACTGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152731.1-342s1c1
Sequence:CCGGCAGAGACAATGGACTCAGAAACTCGAGTTTCTGAGTCCATTGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1247s1c1
Sequence:CCGGCCAGTCAAATAAGCATGCAATCTCGAGATTGCATGCTTATTTGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-779s1c1
Sequence:CCGGGATGAGAAACAGTTCCAGATTCTCGAGAATCTGGAACTGTTTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-844s1c1
Sequence:CCGGCCAGCTATGAATCAGAATGAACTCGAGTTCATTCTGATTCATAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-639s1c1
Sequence:CCGGGAACCATGTCTACATCTGCATCTCGAGATGCAGATGTAGACATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-468s1c1
Sequence:CCGGCAAAGGAAGAATTGTGCGCCACTCGAGTGGCGCACAATTCTTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1669s1c1
Sequence:CCGGCCACCACACTTCTGAAGAATACTCGAGTATTCTTCAGAAGTGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1343s1c1
Sequence:CCGGGCTCTTATCATAGCAGCCAAACTCGAGTTTGGCTGCTATGATAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152731
BEND6 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152731.1-545s1c1
Sequence:CCGGCGACAGTCTTTGGTCATGCTTCTCGAGAAGCATGACCAAAGACTGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152731.1-342s1c1
Sequence:CCGGCAGAGACAATGGACTCAGAAACTCGAGTTTCTGAGTCCATTGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1247s1c1
Sequence:CCGGCCAGTCAAATAAGCATGCAATCTCGAGATTGCATGCTTATTTGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-779s1c1
Sequence:CCGGGATGAGAAACAGTTCCAGATTCTCGAGAATCTGGAACTGTTTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-844s1c1
Sequence:CCGGCCAGCTATGAATCAGAATGAACTCGAGTTCATTCTGATTCATAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-639s1c1
Sequence:CCGGGAACCATGTCTACATCTGCATCTCGAGATGCAGATGTAGACATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-468s1c1
Sequence:CCGGCAAAGGAAGAATTGTGCGCCACTCGAGTGGCGCACAATTCTTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1669s1c1
Sequence:CCGGCCACCACACTTCTGAAGAATACTCGAGTATTCTTCAGAAGTGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1343s1c1
Sequence:CCGGGCTCTTATCATAGCAGCCAAACTCGAGTTTGGCTGCTATGATAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152731
BEND6 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152731.1-545s1c1
Sequence:CCGGCGACAGTCTTTGGTCATGCTTCTCGAGAAGCATGACCAAAGACTGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152731.1-342s1c1
Sequence:CCGGCAGAGACAATGGACTCAGAAACTCGAGTTTCTGAGTCCATTGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1247s1c1
Sequence:CCGGCCAGTCAAATAAGCATGCAATCTCGAGATTGCATGCTTATTTGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-779s1c1
Sequence:CCGGGATGAGAAACAGTTCCAGATTCTCGAGAATCTGGAACTGTTTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-844s1c1
Sequence:CCGGCCAGCTATGAATCAGAATGAACTCGAGTTCATTCTGATTCATAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-639s1c1
Sequence:CCGGGAACCATGTCTACATCTGCATCTCGAGATGCAGATGTAGACATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152731.1-468s1c1
Sequence:CCGGCAAAGGAAGAATTGTGCGCCACTCGAGTGGCGCACAATTCTTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1669s1c1
Sequence:CCGGCCACCACACTTCTGAAGAATACTCGAGTATTCTTCAGAAGTGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136351    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152731.1-1343s1c1
Sequence:CCGGGCTCTTATCATAGCAGCCAAACTCGAGTTTGGCTGCTATGATAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)