EMAIL THIS PAGE TO A FRIEND

BEND7

BEN domain containing 7

238 Gene Product Result for
Synonyms: C10orf30
UniProtKB ID: Q8N7W2, Q5SYY7, Q5SYY8, Q5SYY9, Q8N5T7
Gene ID:
Mouse(209645) BEN domain containing 7
Rat(361275) BEN domain containing 7
sheep(101115641) BEN domain containing 7
Domestic Rabbit(100345188) BEN domain containing 7
naked mole-rat(101706326) BEN domain containing 7
domestic guinea pig(100731377) BEN domain containing 7
chicken(419037) BEN domain containing 7
cow(504404) BEN domain containing 7
Horse(100069127) BEN domain containing 7
domestic cat(101098471) BEN domain containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152751 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100912 Rosetta Predictions human pricing
NM_152751 Rosetta Predictions human pricing
XM_001071606 Rosetta Predictions rat pricing
XM_341560 Rosetta Predictions rat pricing
NM_178663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322505 predicted 867
2 SASI_Hs02_00322506 predicted 897
3 SASI_Hs02_00322507 predicted 803
4 SASI_Hs02_00322508 predicted 866
5 SASI_Hs02_00322509 predicted 802
6 SASI_Hs02_00322510 predicted 929
7 SASI_Hs02_00322511 predicted 803
8 SASI_Hs02_00322512 predicted 893
9 SASI_Hs02_00322513 predicted 684
10 SASI_Hs02_00322514 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194405 predicted 1007
2 SASI_Hs01_00194406 predicted 1028
3 SASI_Hs01_00194408 predicted 931
4 SASI_Hs01_00194410 predicted 998
5 SASI_Hs02_00366671 predicted 932
6 SASI_Hs02_00366672 predicted 1060
7 SASI_Hs02_00366673 predicted 937
8 SASI_Hs02_00366674 predicted 1026
9 SASI_Hs02_00366675 predicted 815
10 SASI_Hs02_00366676 predicted 816
11 SASI_Hs01_00194403 predicted 1150
12 SASI_Hs01_00194404 predicted 722
13 SASI_Hs01_00194407 predicted 1695
14 SASI_Hs01_00194409 predicted 586
15 SASI_Hs01_00194411 predicted 1264
16 SASI_Hs01_00194412 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335717 predicted 453
2 SASI_Rn02_00335718 predicted 510
3 SASI_Rn02_00335719 predicted 379
4 SASI_Rn02_00335720 predicted 849
5 SASI_Rn02_00335721 predicted 495
6 SASI_Rn02_00335722 predicted 754
7 SASI_Rn02_00335723 predicted 486
8 SASI_Rn02_00335724 predicted 785
9 SASI_Rn02_00335725 predicted 775
10 SASI_Rn02_00335726 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393109 predicted 334
2 SASI_Rn02_00393110 predicted 233
3 SASI_Rn02_00393111 predicted 335
4 SASI_Rn02_00393112 predicted 272
5 SASI_Rn02_00393113 predicted 225
6 SASI_Rn02_00393114 predicted 335
7 SASI_Rn02_00393115 predicted 308
8 SASI_Rn02_00393116 predicted 314
9 SASI_Rn02_00393117 predicted 214
10 SASI_Rn02_00393118 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036214 predicted 210
2 SASI_Mm01_00036215 predicted 587
3 SASI_Mm01_00036216 predicted 1096
4 SASI_Mm01_00036217 predicted 1214
5 SASI_Mm01_00036218 predicted 1480
6 SASI_Mm01_00036219 predicted 628
7 SASI_Mm01_00036220 predicted 1171
8 SASI_Mm01_00036221 predicted 991
9 SASI_Mm01_00036222 predicted 976
10 SASI_Mm01_00036223 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178663
BEND7 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-622s1c1
Sequence:CCGGGCTCAAGACCATGAGGAAATTCTCGAGAATTTCCTCATGGTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-208s1c1
Sequence:CCGGCAAAGAGACACAACCCATTTACTCGAGTAAATGGGTTGTGTCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-1250s1c1
Sequence:CCGGGCCAGAAGAAGGTTGAAACGACTCGAGTCGTTTCAACCTTCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-1178s21c1
Sequence:CCGGCTGCGAATCATGTGGATAAACCTCGAGGTTTATCCACATGATTCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-235s21c1
Sequence:CCGGGACGAAAGCATGGAAATTAAACTCGAGTTTAATTTCCATGCTTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178663.3-1516s1c1
Sequence:CCGGCAACTCTGGTTTGGCATAATACTCGAGTATTATGCCAAACCAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-207s21c1
Sequence:CCGGCAAAGAGACACAACCCATTTACTCGAGTAAATGGGTTGTGTCTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-150s21c1
Sequence:CCGGTTATCACCATGAGGTGTATAACTCGAGTTATACACCTCATGGTGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178663.3-1473s21c1
Sequence:CCGGGGCTTGTCCTGTCCGAATAATCTCGAGATTATTCGGACAGGACAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178663
BEND7 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-622s1c1
Sequence:CCGGGCTCAAGACCATGAGGAAATTCTCGAGAATTTCCTCATGGTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-208s1c1
Sequence:CCGGCAAAGAGACACAACCCATTTACTCGAGTAAATGGGTTGTGTCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-1250s1c1
Sequence:CCGGGCCAGAAGAAGGTTGAAACGACTCGAGTCGTTTCAACCTTCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-1178s21c1
Sequence:CCGGCTGCGAATCATGTGGATAAACCTCGAGGTTTATCCACATGATTCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-235s21c1
Sequence:CCGGGACGAAAGCATGGAAATTAAACTCGAGTTTAATTTCCATGCTTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178663.3-1516s1c1
Sequence:CCGGCAACTCTGGTTTGGCATAATACTCGAGTATTATGCCAAACCAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-207s21c1
Sequence:CCGGCAAAGAGACACAACCCATTTACTCGAGTAAATGGGTTGTGTCTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-150s21c1
Sequence:CCGGTTATCACCATGAGGTGTATAACTCGAGTTATACACCTCATGGTGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178663.3-1473s21c1
Sequence:CCGGGGCTTGTCCTGTCCGAATAATCTCGAGATTATTCGGACAGGACAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178663
BEND7 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201208    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-622s1c1
Sequence:CCGGGCTCAAGACCATGAGGAAATTCTCGAGAATTTCCTCATGGTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-208s1c1
Sequence:CCGGCAAAGAGACACAACCCATTTACTCGAGTAAATGGGTTGTGTCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178663.2-1250s1c1
Sequence:CCGGGCCAGAAGAAGGTTGAAACGACTCGAGTCGTTTCAACCTTCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-1178s21c1
Sequence:CCGGCTGCGAATCATGTGGATAAACCTCGAGGTTTATCCACATGATTCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-235s21c1
Sequence:CCGGGACGAAAGCATGGAAATTAAACTCGAGTTTAATTTCCATGCTTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178663.3-1516s1c1
Sequence:CCGGCAACTCTGGTTTGGCATAATACTCGAGTATTATGCCAAACCAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-207s21c1
Sequence:CCGGCAAAGAGACACAACCCATTTACTCGAGTAAATGGGTTGTGTCTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178663.3-150s21c1
Sequence:CCGGTTATCACCATGAGGTGTATAACTCGAGTTATACACCTCATGGTGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178663.3-1473s21c1
Sequence:CCGGGGCTTGTCCTGTCCGAATAATCTCGAGATTATTCGGACAGGACAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152751
VALIDATED
BEND7 MISSION shRNA Bacterial Glycerol Stock
BEN domain containing 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152751.1-1058s1c1
Sequence:CCGGGCTCAGGAAGCCTTCTGTTTACTCGAGTAAACAGAAGGCTTCCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1329s21c1
Sequence:CCGGGATCGCGGACAGTGATGAAAGCTCGAGCTTTCATCACTGTCCGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1270s21c1
Sequence:CCGGCAGATTCTACAGGATCAAATTCTCGAGAATTTGATCCTGTAGAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152751.2-1837s21c1
Sequence:CCGGAGCAAGAGTGGACTGATTAAACTCGAGTTTAATCAGTCCACTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152751.2-735s21c1
Sequence:CCGGACCTCCAATTTCCCTTATATGCTCGAGCATATAAGGGAAATTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1004s21c1
Sequence:CCGGTTGACGTGTTTATGCCTAAATCTCGAGATTTAGGCATAAACACGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152751
VALIDATED
BEND7 MISSION shRNA shRNA Plasmid DNA
BEN domain containing 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152751.1-1058s1c1
Sequence:CCGGGCTCAGGAAGCCTTCTGTTTACTCGAGTAAACAGAAGGCTTCCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1329s21c1
Sequence:CCGGGATCGCGGACAGTGATGAAAGCTCGAGCTTTCATCACTGTCCGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1270s21c1
Sequence:CCGGCAGATTCTACAGGATCAAATTCTCGAGAATTTGATCCTGTAGAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152751.2-1837s21c1
Sequence:CCGGAGCAAGAGTGGACTGATTAAACTCGAGTTTAATCAGTCCACTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152751.2-735s21c1
Sequence:CCGGACCTCCAATTTCCCTTATATGCTCGAGCATATAAGGGAAATTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1004s21c1
Sequence:CCGGTTGACGTGTTTATGCCTAAATCTCGAGATTTAGGCATAAACACGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152751
VALIDATED
BEND7 MISSION shRNA Lentiviral Transduction Particles
BEN domain containing 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152751.1-1058s1c1
Sequence:CCGGGCTCAGGAAGCCTTCTGTTTACTCGAGTAAACAGAAGGCTTCCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1329s21c1
Sequence:CCGGGATCGCGGACAGTGATGAAAGCTCGAGCTTTCATCACTGTCCGCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1270s21c1
Sequence:CCGGCAGATTCTACAGGATCAAATTCTCGAGAATTTGATCCTGTAGAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152751.2-1837s21c1
Sequence:CCGGAGCAAGAGTGGACTGATTAAACTCGAGTTTAATCAGTCCACTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_152751.2-735s21c1
Sequence:CCGGACCTCCAATTTCCCTTATATGCTCGAGCATATAAGGGAAATTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152751.2-1004s21c1
Sequence:CCGGTTGACGTGTTTATGCCTAAATCTCGAGATTTAGGCATAAACACGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)