EMAIL THIS PAGE TO A FRIEND

BEST1

bestrophin 1

91 Gene Product Result for
Synonyms: ARB BEST BMD RP50 TU15B VMD2
Gene ID:
Human(7439) Summary: This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
Mouse(24115) bestrophin 1
Rat(293735) bestrophin 1
fruit fly(53431) Bestrophin 1
cow(508924) bestrophin 1
Horse(100059901) bestrophin 1
dog(483791) bestrophin 1
chicken(423124) bestrophin 1
sheep(101109837) bestrophin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004183 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004183 Rosetta Predictions human pricing
NM_001011940 Rosetta Predictions rat pricing
XM_574621 Rosetta Predictions rat pricing
NM_011913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055652 predicted 737
2 SASI_Hs01_00055654 predicted 1951
3 SASI_Hs01_00055655 predicted 784
4 SASI_Hs01_00055656 predicted 581
5 SASI_Hs01_00055657 predicted 1172
6 SASI_Hs01_00055658 predicted 1714
7 SASI_Hs01_00055659 predicted 1842
8 SASI_Hs01_00055660 predicted 1936
9 SASI_Hs01_00055661 predicted 227
10 SASI_Hs02_00337066 predicted 343
11 SASI_Hs01_00055653 predicted 1822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066888 predicted 300
2 SASI_Rn01_00066889 predicted 837
3 SASI_Rn01_00066890 predicted 734
4 SASI_Rn02_00199957 predicted 294
5 SASI_Rn01_00066892 predicted 1655
6 SASI_Rn01_00066893 predicted 973
7 SASI_Rn01_00066894 predicted 379
8 SASI_Rn02_00199958 predicted 975
9 SASI_Rn01_00066895 predicted 825
10 SASI_Rn01_00066896 predicted 1378
11 SASI_Rn01_00066887 predicted 817
12 SASI_Rn01_00066891 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193478 predicted 293
2 SASI_Rn01_00193479 predicted 386
3 SASI_Rn01_00193480 predicted 383
4 SASI_Rn01_00193481 predicted 347
5 SASI_Rn01_00193482 predicted 339
6 SASI_Rn01_00193483 predicted 292
7 SASI_Rn01_00193484 predicted 426
8 SASI_Rn01_00193485 predicted 275
9 SASI_Rn01_00193486 predicted 287
10 SASI_Rn01_00193487 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183091 predicted 1189
2 SASI_Mm01_00183093 predicted 1032
3 SASI_Mm02_00321736 predicted 359
4 SASI_Mm01_00183095 predicted 1546
5 SASI_Mm01_00183096 predicted 448
6 SASI_Mm01_00183097 predicted 1313
7 SASI_Mm01_00183098 predicted 1437
8 SASI_Mm01_00183099 predicted 646
9 SASI_Mm01_00183100 predicted 450
10 SASI_Mm02_00321737 predicted 769
11 SASI_Mm01_00183092 predicted 1243
12 SASI_Mm01_00183094 predicted 1610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004183
VALIDATED
BEST1 MISSION shRNA Bacterial Glycerol Stock
bestrophin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1505s21c1
Sequence:CCGGTGGATTGTCGACAGGAATTTGCTCGAGCAAATTCCTGTCGACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1731s21c1
Sequence:CCGGATGCTCACGCTGGCATCATTGCTCGAGCAATGATGCCAGCGTGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1256s21c1
Sequence:CCGGGCCTACGACTGGATTAGTATCCTCGAGGATACTAATCCAGTCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004183.1-283s1c1
Sequence:CCGGGACTCTGTATTGCGACAGCTACTCGAGTAGCTGTCGCAATACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-587s1c1
Sequence:CCGGGAACACAAGCAGTTGGAGAAACTCGAGTTTCTCCAACTGCTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-1697s1c1
Sequence:CCGGGTGGAGTTTAACCTGACGGATCTCGAGATCCGTCAGGTTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004183.1-178s1c1
Sequence:CCGGGCTGCTATATGGCGAGTTCTTCTCGAGAAGAACTCGCCATATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-1087s1c1
Sequence:CCGGGCCGGACATGTACTGGAATAACTCGAGTTATTCCAGTACATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004183.1-1961s1c1
Sequence:CCGGACAGCCTGAATCAAATGGTTACTCGAGTAACCATTTGATTCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004183.1-1964s1c1
Sequence:CCGGGCCTGAATCAAATGGTTAGCTCTCGAGAGCTAACCATTTGATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004183
VALIDATED
BEST1 MISSION shRNA shRNA Plasmid DNA
bestrophin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1505s21c1
Sequence:CCGGTGGATTGTCGACAGGAATTTGCTCGAGCAAATTCCTGTCGACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1731s21c1
Sequence:CCGGATGCTCACGCTGGCATCATTGCTCGAGCAATGATGCCAGCGTGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1256s21c1
Sequence:CCGGGCCTACGACTGGATTAGTATCCTCGAGGATACTAATCCAGTCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004183.1-283s1c1
Sequence:CCGGGACTCTGTATTGCGACAGCTACTCGAGTAGCTGTCGCAATACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-587s1c1
Sequence:CCGGGAACACAAGCAGTTGGAGAAACTCGAGTTTCTCCAACTGCTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-1697s1c1
Sequence:CCGGGTGGAGTTTAACCTGACGGATCTCGAGATCCGTCAGGTTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004183.1-178s1c1
Sequence:CCGGGCTGCTATATGGCGAGTTCTTCTCGAGAAGAACTCGCCATATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-1087s1c1
Sequence:CCGGGCCGGACATGTACTGGAATAACTCGAGTTATTCCAGTACATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004183.1-1961s1c1
Sequence:CCGGACAGCCTGAATCAAATGGTTACTCGAGTAACCATTTGATTCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004183.1-1964s1c1
Sequence:CCGGGCCTGAATCAAATGGTTAGCTCTCGAGAGCTAACCATTTGATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004183
VALIDATED
BEST1 MISSION shRNA Lentiviral Transduction Particles
bestrophin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1505s21c1
Sequence:CCGGTGGATTGTCGACAGGAATTTGCTCGAGCAAATTCCTGTCGACAATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1731s21c1
Sequence:CCGGATGCTCACGCTGGCATCATTGCTCGAGCAATGATGCCAGCGTGAGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004183.3-1256s21c1
Sequence:CCGGGCCTACGACTGGATTAGTATCCTCGAGGATACTAATCCAGTCGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004183.1-283s1c1
Sequence:CCGGGACTCTGTATTGCGACAGCTACTCGAGTAGCTGTCGCAATACAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-587s1c1
Sequence:CCGGGAACACAAGCAGTTGGAGAAACTCGAGTTTCTCCAACTGCTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-1697s1c1
Sequence:CCGGGTGGAGTTTAACCTGACGGATCTCGAGATCCGTCAGGTTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004183.1-178s1c1
Sequence:CCGGGCTGCTATATGGCGAGTTCTTCTCGAGAAGAACTCGCCATATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004183.1-1087s1c1
Sequence:CCGGGCCGGACATGTACTGGAATAACTCGAGTTATTCCAGTACATGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004183.1-1961s1c1
Sequence:CCGGACAGCCTGAATCAAATGGTTACTCGAGTAACCATTTGATTCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004183.1-1964s1c1
Sequence:CCGGGCCTGAATCAAATGGTTAGCTCTCGAGAGCTAACCATTTGATTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011913
BEST1 MISSION shRNA Bacterial Glycerol Stock
bestrophin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-175s1c1
Sequence:CCGGCGTGGACTCTACAGAATGGTTCTCGAGAACCATTCTGTAGAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-1369s1c1
Sequence:CCGGCTGGACTTCTTGAAATGTGTTCTCGAGAACACATTTCAAGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-1380s1c1
Sequence:CCGGGAAATGTGTTCCAAGGTTTAACTCGAGTTAAACCTTGGAACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-153s1c1
Sequence:CCGGCATATTCCTCTACTATTCCATCTCGAGATGGAATAGTAGAGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-717s1c1
Sequence:CCGGCGACTGGATAAGTATCCCATTCTCGAGAATGGGATACTTATCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011913
BEST1 MISSION shRNA shRNA Plasmid DNA
bestrophin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-175s1c1
Sequence:CCGGCGTGGACTCTACAGAATGGTTCTCGAGAACCATTCTGTAGAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-1369s1c1
Sequence:CCGGCTGGACTTCTTGAAATGTGTTCTCGAGAACACATTTCAAGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-1380s1c1
Sequence:CCGGGAAATGTGTTCCAAGGTTTAACTCGAGTTAAACCTTGGAACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-153s1c1
Sequence:CCGGCATATTCCTCTACTATTCCATCTCGAGATGGAATAGTAGAGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-717s1c1
Sequence:CCGGCGACTGGATAAGTATCCCATTCTCGAGAATGGGATACTTATCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011913
BEST1 MISSION shRNA Lentiviral Transduction Particles
bestrophin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-175s1c1
Sequence:CCGGCGTGGACTCTACAGAATGGTTCTCGAGAACCATTCTGTAGAGTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-1369s1c1
Sequence:CCGGCTGGACTTCTTGAAATGTGTTCTCGAGAACACATTTCAAGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-1380s1c1
Sequence:CCGGGAAATGTGTTCCAAGGTTTAACTCGAGTTAAACCTTGGAACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-153s1c1
Sequence:CCGGCATATTCCTCTACTATTCCATCTCGAGATGGAATAGTAGAGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011913.1-717s1c1
Sequence:CCGGCGACTGGATAAGTATCCCATTCTCGAGAATGGGATACTTATCCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks