EMAIL THIS PAGE TO A FRIEND

BEST2

bestrophin 2

67 Gene Product Result for
Synonyms: VMD2L1
UniProtKB ID: Q8NFU1, Q53YQ8, Q9NXP0
Gene ID:
Human(54831) Summary: This gene is a member of the bestrophin gene family of anion channels. Bestrophin genes share a similar gene structure with highly conserved exon-intron boundaries, but with distinct 3' ends. Bestrophins are transmembrane proteins that contain a homologous region rich in aromatic residues, including an invariant arg-phe-pro motif. Mutation in one of the family members (bestrophin 1) is associated with vitelliform macular dystrophy. The bestrophin 2 gene is mainly expressed in the retinal pigment epithelium and colon. [provided by RefSeq, Jul 2008]
Mouse(212989) bestrophin 2
Rat(364973) bestrophin 2
sheep(101123465) bestrophin 2
Zebrafish(567214) bestrophin 2
cow(529463) bestrophin 2
dog(484929) bestrophin 2
fruit fly(38727) Bestrophin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017682 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080851 MISSION® esiRNA esiRNA targeting mouse Best2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017682 Rosetta Predictions human pricing
NM_001108895 Rosetta Predictions rat pricing
NM_001130193 Rosetta Predictions mouse pricing
NM_001130194 Rosetta Predictions mouse pricing
NM_145388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106062 predicted 519
2 SASI_Hs01_00106063 predicted 952
3 SASI_Hs01_00106064 predicted 810
4 SASI_Hs01_00106065 predicted 717
5 SASI_Hs01_00106066 predicted 402
6 SASI_Hs01_00106067 predicted 913
7 SASI_Hs01_00106068 predicted 711
8 SASI_Hs01_00106069 predicted 598
9 SASI_Hs01_00106071 predicted 362
10 SASI_Hs02_00350433 predicted 1428
11 SASI_Hs01_00106070 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243145 predicted 719
2 SASI_Rn02_00243146 predicted 729
3 SASI_Rn02_00243147 predicted 308
4 SASI_Rn02_00243148 predicted 356
5 SASI_Rn02_00243149 predicted 281
6 SASI_Rn02_00243150 predicted 956
7 SASI_Rn02_00243151 predicted 1350
8 SASI_Rn02_00243152 predicted 751
9 SASI_Rn02_00243153 predicted 289
10 SASI_Rn02_00243154 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311128 predicted 736
2 SASI_Mm02_00311129 predicted 365
3 SASI_Mm02_00311130 predicted 317
4 SASI_Mm02_00311131 predicted 859
5 SASI_Mm02_00311132 predicted 765
6 SASI_Mm02_00311133 predicted 647
7 SASI_Mm02_00311134 predicted 599
8 SASI_Mm02_00311135 predicted 1724
9 SASI_Mm02_00311136 predicted 1080
10 SASI_Mm02_00311137 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311138 predicted 696
2 SASI_Mm02_00311139 predicted 316
3 SASI_Mm02_00311140 predicted 272
4 SASI_Mm02_00311141 predicted 817
5 SASI_Mm02_00311142 predicted 721
6 SASI_Mm02_00311143 predicted 598
7 SASI_Mm02_00311144 predicted 557
8 SASI_Mm02_00311145 predicted 1688
9 SASI_Mm02_00311146 predicted 1045
10 SASI_Mm02_00311147 predicted 1644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076129 predicted 811
2 SASI_Mm01_00076130 predicted 437
3 SASI_Mm01_00076131 predicted 394
4 SASI_Mm01_00076132 predicted 933
5 SASI_Mm01_00076133 predicted 835
6 SASI_Mm02_00340706 predicted 721
7 SASI_Mm01_00076136 predicted 681
8 SASI_Mm01_00076137 predicted 1807
9 SASI_Mm01_00076138 predicted 1161
10 SASI_Mm02_00340707 predicted 1759
11 SASI_Mm01_00076134 predicted 782
12 SASI_Mm01_00076135 predicted 1616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017682
BEST2 MISSION shRNA Bacterial Glycerol Stock
bestrophin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017682.1-1554s1c1
Sequence:CCGGCCTTTGTAAAGTCCACCTACACTCGAGTGTAGGTGGACTTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-454s1c1
Sequence:CCGGCCTGAACTCATCCTACAACAACTCGAGTTGTTGTAGGATGAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017682.1-604s1c1
Sequence:CCGGGCTCTTTCACTATGACTGGATCTCGAGATCCAGTCATAGTGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-605s1c1
Sequence:CCGGCTCTTTCACTATGACTGGATTCTCGAGAATCCAGTCATAGTGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-842s1c1
Sequence:CCGGGATGACTTTGAGACCAACTTTCTCGAGAAAGTTGGTCTCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-847s1c1
Sequence:CCGGCTTTGAGACCAACTTTCTGATCTCGAGATCAGAAAGTTGGTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017682.1-1548s1c1
Sequence:CCGGCGTATGCCTTTGTAAAGTCCACTCGAGTGGACTTTACAAAGGCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-1518s21c1
Sequence:CCGGGAATCTGGCCTGAGATCTTAGCTCGAGCTAAGATCTCAGGCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-807s21c1
Sequence:CCGGAGACCTGTGTGTGCCCATCTTCTCGAGAAGATGGGCACACACAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-72s21c1
Sequence:CCGGGCGTGGGAGCATCTACAAACTCTCGAGAGTTTGTAGATGCTCCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017682
BEST2 MISSION shRNA shRNA Plasmid DNA
bestrophin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017682.1-1554s1c1
Sequence:CCGGCCTTTGTAAAGTCCACCTACACTCGAGTGTAGGTGGACTTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-454s1c1
Sequence:CCGGCCTGAACTCATCCTACAACAACTCGAGTTGTTGTAGGATGAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017682.1-604s1c1
Sequence:CCGGGCTCTTTCACTATGACTGGATCTCGAGATCCAGTCATAGTGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-605s1c1
Sequence:CCGGCTCTTTCACTATGACTGGATTCTCGAGAATCCAGTCATAGTGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-842s1c1
Sequence:CCGGGATGACTTTGAGACCAACTTTCTCGAGAAAGTTGGTCTCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-847s1c1
Sequence:CCGGCTTTGAGACCAACTTTCTGATCTCGAGATCAGAAAGTTGGTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017682.1-1548s1c1
Sequence:CCGGCGTATGCCTTTGTAAAGTCCACTCGAGTGGACTTTACAAAGGCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-1518s21c1
Sequence:CCGGGAATCTGGCCTGAGATCTTAGCTCGAGCTAAGATCTCAGGCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-807s21c1
Sequence:CCGGAGACCTGTGTGTGCCCATCTTCTCGAGAAGATGGGCACACACAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-72s21c1
Sequence:CCGGGCGTGGGAGCATCTACAAACTCTCGAGAGTTTGTAGATGCTCCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017682
BEST2 MISSION shRNA Lentiviral Transduction Particles
bestrophin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017682.1-1554s1c1
Sequence:CCGGCCTTTGTAAAGTCCACCTACACTCGAGTGTAGGTGGACTTTACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-454s1c1
Sequence:CCGGCCTGAACTCATCCTACAACAACTCGAGTTGTTGTAGGATGAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017682.1-604s1c1
Sequence:CCGGGCTCTTTCACTATGACTGGATCTCGAGATCCAGTCATAGTGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-605s1c1
Sequence:CCGGCTCTTTCACTATGACTGGATTCTCGAGAATCCAGTCATAGTGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-842s1c1
Sequence:CCGGGATGACTTTGAGACCAACTTTCTCGAGAAAGTTGGTCTCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017682.1-847s1c1
Sequence:CCGGCTTTGAGACCAACTTTCTGATCTCGAGATCAGAAAGTTGGTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017682.1-1548s1c1
Sequence:CCGGCGTATGCCTTTGTAAAGTCCACTCGAGTGGACTTTACAAAGGCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-1518s21c1
Sequence:CCGGGAATCTGGCCTGAGATCTTAGCTCGAGCTAAGATCTCAGGCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-807s21c1
Sequence:CCGGAGACCTGTGTGTGCCCATCTTCTCGAGAAGATGGGCACACACAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017682.2-72s21c1
Sequence:CCGGGCGTGGGAGCATCTACAAACTCTCGAGAGTTTGTAGATGCTCCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145388
BEST2 MISSION shRNA Bacterial Glycerol Stock
bestrophin 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145388.1-728s1c1
Sequence:CCGGGCTGTTTCACTACGACTGGATCTCGAGATCCAGTCGTAGTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-1150s1c1
Sequence:CCGGCCTTTGATATAGCGCTGGCTACTCGAGTAGCCAGCGCTATATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-1017s1c1
Sequence:CCGGCTAGCTGTAGATGAGATGTATCTCGAGATACATCTCATCTACAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-293s1c1
Sequence:CCGGCTCTTTCGTACTTGGCTTCTACTCGAGTAGAAGCCAAGTACGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145388.1-729s1c1
Sequence:CCGGCTGTTTCACTACGACTGGATTCTCGAGAATCCAGTCGTAGTGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-931s1c1
Sequence:CCGGCAGAGCAGCTTATTAACCCTTCTCGAGAAGGGTTAATAAGCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145388
BEST2 MISSION shRNA shRNA Plasmid DNA
bestrophin 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145388.1-728s1c1
Sequence:CCGGGCTGTTTCACTACGACTGGATCTCGAGATCCAGTCGTAGTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-1150s1c1
Sequence:CCGGCCTTTGATATAGCGCTGGCTACTCGAGTAGCCAGCGCTATATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-1017s1c1
Sequence:CCGGCTAGCTGTAGATGAGATGTATCTCGAGATACATCTCATCTACAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-293s1c1
Sequence:CCGGCTCTTTCGTACTTGGCTTCTACTCGAGTAGAAGCCAAGTACGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145388.1-729s1c1
Sequence:CCGGCTGTTTCACTACGACTGGATTCTCGAGAATCCAGTCGTAGTGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-931s1c1
Sequence:CCGGCAGAGCAGCTTATTAACCCTTCTCGAGAAGGGTTAATAAGCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145388
BEST2 MISSION shRNA Lentiviral Transduction Particles
bestrophin 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145388.1-728s1c1
Sequence:CCGGGCTGTTTCACTACGACTGGATCTCGAGATCCAGTCGTAGTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-1150s1c1
Sequence:CCGGCCTTTGATATAGCGCTGGCTACTCGAGTAGCCAGCGCTATATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-1017s1c1
Sequence:CCGGCTAGCTGTAGATGAGATGTATCTCGAGATACATCTCATCTACAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-293s1c1
Sequence:CCGGCTCTTTCGTACTTGGCTTCTACTCGAGTAGAAGCCAAGTACGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181353    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145388.1-729s1c1
Sequence:CCGGCTGTTTCACTACGACTGGATTCTCGAGAATCCAGTCGTAGTGAAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145388.1-931s1c1
Sequence:CCGGCAGAGCAGCTTATTAACCCTTCTCGAGAAGGGTTAATAAGCTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks