EMAIL THIS PAGE TO A FRIEND

BEST3

bestrophin 3

120 Gene Product Result for
Synonyms: VMD2L3
UniProtKB ID: Q8N1M1, B5MDI8, Q53YQ7, Q8N356, Q8NFT9, Q9BR80
Gene ID:
Human(144453) Summary: BEST3 belongs to the bestrophin family of anion channels, which includes BEST1 (MIM 607854), the gene mutant in vitelliform macular dystrophy (VMD; MIM 153700), and 2 other BEST1-like genes, BEST2 (MIM 607335) and BEST4 (MIM 607336). Bestrophins are transmembrane (TM) proteins that share a homology region containing a high content of aromatic residues, including an invariant arg-phe-pro (RFP) motif. The bestrophin genes share a conserved gene structure, with almost identical sizes of the 8 RFP-TM domain-encoding exons and highly conserved exon-intron boundaries. Each of the 4 bestrophin genes has a unique 3-prime end of variable length (Stohr et al., 2002 [PubMed 12032738]
Mouse(382427) bestrophin 3
Rat(314847) bestrophin 3
fruit fly(39661) Bestrophin 3
cow(531070) bestrophin 3
Horse(100052270) bestrophin 3
dog(481158) bestrophin 3
chicken(417849) bestrophin 3
sheep(101123543) bestrophin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001007583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001007583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032735 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097781 MISSION® esiRNA esiRNA human BEST3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032735 Rosetta Predictions human pricing
NM_152439 Rosetta Predictions human pricing
XM_001080943 Rosetta Predictions rat pricing
XM_235161 Rosetta Predictions rat pricing
NM_001007583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360273 predicted 2092
2 SASI_Hs02_00360274 predicted 2170
3 SASI_Hs02_00360275 predicted 2233
4 SASI_Hs02_00360276 predicted 1655
5 SASI_Hs02_00360277 predicted 2289
6 SASI_Hs02_00360278 predicted 2178
7 SASI_Hs02_00360279 predicted 2099
8 SASI_Hs02_00360280 predicted 2207
9 SASI_Hs02_00360281 predicted 2119
10 SASI_Hs02_00360282 predicted 1470
11 SASI_Hs01_00239076 predicted 898
12 SASI_Hs01_00239077 predicted 245
13 SASI_Hs01_00239078 predicted 424
14 SASI_Hs01_00239079 predicted 313
15 SASI_Hs01_00239080 predicted 267
16 SASI_Hs01_00239081 predicted 542
17 SASI_Hs01_00239082 predicted 477
18 SASI_Hs01_00239083 predicted 573
19 SASI_Hs01_00239084 predicted 629
20 SASI_Hs01_00239085 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366181 predicted 1437
2 SASI_Hs02_00366182 predicted 1521
3 SASI_Hs02_00366183 predicted 1584
4 SASI_Hs02_00366184 predicted 996
5 SASI_Hs02_00366185 predicted 1635
6 SASI_Hs02_00366186 predicted 1533
7 SASI_Hs02_00366187 predicted 1448
8 SASI_Hs02_00366188 predicted 1554
9 SASI_Hs02_00366189 predicted 1463
10 SASI_Hs01_00036392 predicted 810
11 SASI_Hs01_00036386 predicted 325
12 SASI_Hs01_00036387 predicted 586
13 SASI_Hs01_00036388 predicted 1018
14 SASI_Hs01_00036389 predicted 349
15 SASI_Hs01_00036390 predicted 590
16 SASI_Hs01_00036391 predicted 317
17 SASI_Hs01_00036393 predicted 358
18 SASI_Hs01_00036394 predicted 352
19 SASI_Hs01_00036395 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369970 predicted 1518
2 SASI_Rn02_00369971 predicted 517
3 SASI_Rn02_00369972 predicted 1175
4 SASI_Rn02_00369973 predicted 1027
5 SASI_Rn02_00369974 predicted 704
6 SASI_Rn02_00369975 predicted 1813
7 SASI_Rn02_00369976 predicted 2460
8 SASI_Rn02_00369977 predicted 715
9 SASI_Rn02_00369978 predicted 645
10 SASI_Rn02_00369979 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389035 predicted 1511
2 SASI_Rn02_00389036 predicted 522
3 SASI_Rn02_00389037 predicted 1175
4 SASI_Rn02_00389038 predicted 1033
5 SASI_Rn02_00389039 predicted 704
6 SASI_Rn02_00389040 predicted 1809
7 SASI_Rn02_00389041 predicted 722
8 SASI_Rn02_00389042 predicted 648
9 SASI_Rn02_00389043 predicted 1512
10 SASI_Rn02_00389044 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020126 predicted 2417
2 SASI_Mm01_00020127 predicted 1310
3 SASI_Mm01_00020128 predicted 1174
4 SASI_Mm01_00020129 predicted 521
5 SASI_Mm01_00020130 predicted 1004
6 SASI_Mm01_00020131 predicted 708
7 SASI_Mm01_00020132 predicted 1511
8 SASI_Mm01_00020133 predicted 641
9 SASI_Mm01_00020134 predicted 1477
10 SASI_Mm01_00020135 predicted 2172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152439
BEST3 MISSION shRNA Bacterial Glycerol Stock
bestrophin 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-312s1c1
Sequence:CCGGGCAACTAAAGCCCGGAATGAACTCGAGTTCATTCCGGGCTTTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152439.1-2526s1c1
Sequence:CCGGCGAAGCCAAGAGAATATGAAACTCGAGTTTCATATTCTCTTGGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152439.1-1827s1c1
Sequence:CCGGCCACAGTGATTTAGCCAAATACTCGAGTATTTGGCTAAATCACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-552s1c1
Sequence:CCGGGACGAAATGCACATGAGCTTACTCGAGTAAGCTCATGTGCATTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-574s1c1
Sequence:CCGGCCAAGATGAAGAAGGACATTTCTCGAGAAATGTCCTTCTTCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152439
BEST3 MISSION shRNA shRNA Plasmid DNA
bestrophin 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-312s1c1
Sequence:CCGGGCAACTAAAGCCCGGAATGAACTCGAGTTCATTCCGGGCTTTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152439.1-2526s1c1
Sequence:CCGGCGAAGCCAAGAGAATATGAAACTCGAGTTTCATATTCTCTTGGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152439.1-1827s1c1
Sequence:CCGGCCACAGTGATTTAGCCAAATACTCGAGTATTTGGCTAAATCACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-552s1c1
Sequence:CCGGGACGAAATGCACATGAGCTTACTCGAGTAAGCTCATGTGCATTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-574s1c1
Sequence:CCGGCCAAGATGAAGAAGGACATTTCTCGAGAAATGTCCTTCTTCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152439
BEST3 MISSION shRNA Lentiviral Transduction Particles
bestrophin 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-312s1c1
Sequence:CCGGGCAACTAAAGCCCGGAATGAACTCGAGTTCATTCCGGGCTTTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152439.1-2526s1c1
Sequence:CCGGCGAAGCCAAGAGAATATGAAACTCGAGTTTCATATTCTCTTGGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152439.1-1827s1c1
Sequence:CCGGCCACAGTGATTTAGCCAAATACTCGAGTATTTGGCTAAATCACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-552s1c1
Sequence:CCGGGACGAAATGCACATGAGCTTACTCGAGTAAGCTCATGTGCATTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152439.1-574s1c1
Sequence:CCGGCCAAGATGAAGAAGGACATTTCTCGAGAAATGTCCTTCTTCATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007583
BEST3 MISSION shRNA Bacterial Glycerol Stock
bestrophin 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007583.1-2527s1c1
Sequence:CCGGCCAGCTCCCTACTTTACATAACTCGAGTTATGTAAAGTAGGGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-605s1c1
Sequence:CCGGGCTGCTGTACAGGGAATTTATCTCGAGATAAATTCCCTGTACAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-792s1c1
Sequence:CCGGTGGTGGAACCAGTTTGTGAATCTCGAGATTCACAAACTGGTTCCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-1127s1c1
Sequence:CCGGCGTTGATCTACAATCACTGATCTCGAGATCAGTGATTGTAGATCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-2292s1c1
Sequence:CCGGCTGGGAAACTTAGGTCCAGATCTCGAGATCTGGACCTAAGTTTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007583
BEST3 MISSION shRNA shRNA Plasmid DNA
bestrophin 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007583.1-2527s1c1
Sequence:CCGGCCAGCTCCCTACTTTACATAACTCGAGTTATGTAAAGTAGGGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-605s1c1
Sequence:CCGGGCTGCTGTACAGGGAATTTATCTCGAGATAAATTCCCTGTACAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-792s1c1
Sequence:CCGGTGGTGGAACCAGTTTGTGAATCTCGAGATTCACAAACTGGTTCCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-1127s1c1
Sequence:CCGGCGTTGATCTACAATCACTGATCTCGAGATCAGTGATTGTAGATCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-2292s1c1
Sequence:CCGGCTGGGAAACTTAGGTCCAGATCTCGAGATCTGGACCTAAGTTTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007583
BEST3 MISSION shRNA Lentiviral Transduction Particles
bestrophin 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007583.1-2527s1c1
Sequence:CCGGCCAGCTCCCTACTTTACATAACTCGAGTTATGTAAAGTAGGGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-605s1c1
Sequence:CCGGGCTGCTGTACAGGGAATTTATCTCGAGATAAATTCCCTGTACAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-792s1c1
Sequence:CCGGTGGTGGAACCAGTTTGTGAATCTCGAGATTCACAAACTGGTTCCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-1127s1c1
Sequence:CCGGCGTTGATCTACAATCACTGATCTCGAGATCAGTGATTGTAGATCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007583.1-2292s1c1
Sequence:CCGGCTGGGAAACTTAGGTCCAGATCTCGAGATCTGGACCTAAGTTTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032735
BEST3 MISSION shRNA Bacterial Glycerol Stock
bestrophin 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-1251s1c1
Sequence:CCGGGCGGTCAGAACAGTTTGGTTTCTCGAGAAACCAAACTGTTCTGACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-367s1c1
Sequence:CCGGGAACTGGCATGAAACCCATTCCTCGAGGAATGGGTTTCATGCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-437s1c1
Sequence:CCGGCCTCGTTTGAATACTCTGCTTCTCGAGAAGCAGAGTATTCAAACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-440s1c1
Sequence:CCGGCGTTTGAATACTCTGCTTGAACTCGAGTTCAAGCAGAGTATTCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-620s1c1
Sequence:CCGGCCATCAAAGCACAACTCAATTCTCGAGAATTGAGTTGTGCTTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-477s1c1
Sequence:CCGGCCTCAACTTCAATCAAGGAAACTCGAGTTTCCTTGATTGAAGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-360s1c1
Sequence:CCGGGCAGAAAGAACTGGCATGAAACTCGAGTTTCATGCCAGTTCTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-361s1c1
Sequence:CCGGCAGAAAGAACTGGCATGAAACCTCGAGGTTTCATGCCAGTTCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-374s1c1
Sequence:CCGGCATGAAACCCATTCTGCCTTCCTCGAGGAAGGCAGAATGGGTTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-373s1c1
Sequence:CCGGGCATGAAACCCATTCTGCCTTCTCGAGAAGGCAGAATGGGTTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-377s1c1
Sequence:CCGGGAAACCCATTCTGCCTTCAAGCTCGAGCTTGAAGGCAGAATGGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032735
BEST3 MISSION shRNA shRNA Plasmid DNA
bestrophin 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-1251s1c1
Sequence:CCGGGCGGTCAGAACAGTTTGGTTTCTCGAGAAACCAAACTGTTCTGACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-367s1c1
Sequence:CCGGGAACTGGCATGAAACCCATTCCTCGAGGAATGGGTTTCATGCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-437s1c1
Sequence:CCGGCCTCGTTTGAATACTCTGCTTCTCGAGAAGCAGAGTATTCAAACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-440s1c1
Sequence:CCGGCGTTTGAATACTCTGCTTGAACTCGAGTTCAAGCAGAGTATTCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-620s1c1
Sequence:CCGGCCATCAAAGCACAACTCAATTCTCGAGAATTGAGTTGTGCTTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-477s1c1
Sequence:CCGGCCTCAACTTCAATCAAGGAAACTCGAGTTTCCTTGATTGAAGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-360s1c1
Sequence:CCGGGCAGAAAGAACTGGCATGAAACTCGAGTTTCATGCCAGTTCTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-361s1c1
Sequence:CCGGCAGAAAGAACTGGCATGAAACCTCGAGGTTTCATGCCAGTTCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-374s1c1
Sequence:CCGGCATGAAACCCATTCTGCCTTCCTCGAGGAAGGCAGAATGGGTTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-373s1c1
Sequence:CCGGGCATGAAACCCATTCTGCCTTCTCGAGAAGGCAGAATGGGTTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-377s1c1
Sequence:CCGGGAAACCCATTCTGCCTTCAAGCTCGAGCTTGAAGGCAGAATGGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032735
BEST3 MISSION shRNA Lentiviral Transduction Particles
bestrophin 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-1251s1c1
Sequence:CCGGGCGGTCAGAACAGTTTGGTTTCTCGAGAAACCAAACTGTTCTGACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-367s1c1
Sequence:CCGGGAACTGGCATGAAACCCATTCCTCGAGGAATGGGTTTCATGCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-437s1c1
Sequence:CCGGCCTCGTTTGAATACTCTGCTTCTCGAGAAGCAGAGTATTCAAACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-440s1c1
Sequence:CCGGCGTTTGAATACTCTGCTTGAACTCGAGTTCAAGCAGAGTATTCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-620s1c1
Sequence:CCGGCCATCAAAGCACAACTCAATTCTCGAGAATTGAGTTGTGCTTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-477s1c1
Sequence:CCGGCCTCAACTTCAATCAAGGAAACTCGAGTTTCCTTGATTGAAGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-360s1c1
Sequence:CCGGGCAGAAAGAACTGGCATGAAACTCGAGTTTCATGCCAGTTCTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-361s1c1
Sequence:CCGGCAGAAAGAACTGGCATGAAACCTCGAGGTTTCATGCCAGTTCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-374s1c1
Sequence:CCGGCATGAAACCCATTCTGCCTTCCTCGAGGAAGGCAGAATGGGTTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-373s1c1
Sequence:CCGGGCATGAAACCCATTCTGCCTTCTCGAGAAGGCAGAATGGGTTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032735.1-377s1c1
Sequence:CCGGGAAACCCATTCTGCCTTCAAGCTCGAGCTTGAAGGCAGAATGGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)