EMAIL THIS PAGE TO A FRIEND

BEST4

bestrophin 4

40 Gene Product Result for
Synonyms: VMD2L2
UniProtKB ID: Q8NFU0, Q5JR93
Gene ID:
Human(266675) Summary: This gene is a member of the bestrophin gene family of anion channels. Bestrophin genes share a similar gene structure with highly conserved exon-intron boundaries, but with distinct 3' ends. Bestrophins are transmembrane proteins that contain a homologous region rich in aromatic residues, including an invariant arg-phe-pro motif. Mutation in one of the family members (bestrophin 1) is associated with vitelliform macular dystrophy. The bestrophin 4 gene is predominantly expressed in the colon. [provided by RefSeq, Jul 2008]
Rat(689103) bestrophin 4
sheep(101118062) bestrophin 4
Zebrafish(563711) bestrophin 4
fruit fly(39660) Bestrophin 4
chicken(771694) bestrophin 4
cow(510542) bestrophin 4
Horse(100052813) bestrophin 4
dog(482521) bestrophin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153274 Rosetta Predictions human pricing
XM_001066260 Rosetta Predictions rat pricing
XM_001066317 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024687 predicted 1039
2 SASI_Hs01_00024688 predicted 713
3 SASI_Hs01_00024689 predicted 467
4 SASI_Hs01_00024690 predicted 263
5 SASI_Hs01_00024691 predicted 696
6 SASI_Hs01_00024692 predicted 705
7 SASI_Hs01_00024693 predicted 289
8 SASI_Hs01_00024694 predicted 700
9 SASI_Hs01_00024695 predicted 749
10 SASI_Hs01_00024696 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316864 predicted 306
2 SASI_Rn02_00316865 predicted 913
3 SASI_Rn02_00316866 predicted 357
4 SASI_Rn02_00316867 predicted 1008
5 SASI_Rn02_00316868 predicted 243
6 SASI_Rn02_00316869 predicted 461
7 SASI_Rn02_00316870 predicted 930
8 SASI_Rn02_00316871 predicted 928
9 SASI_Rn02_00316872 predicted 276
10 SASI_Rn02_00316873 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317049 predicted 1068
2 SASI_Rn02_00317050 predicted 312
3 SASI_Rn02_00317051 predicted 1072
4 SASI_Rn02_00317052 predicted 355
5 SASI_Rn02_00317053 predicted 1168
6 SASI_Rn02_00317054 predicted 463
7 SASI_Rn02_00317055 predicted 1091
8 SASI_Rn02_00317056 predicted 1090
9 SASI_Rn02_00317057 predicted 275
10 SASI_Rn02_00317058 predicted 411
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153274
BEST4 MISSION shRNA Bacterial Glycerol Stock
bestrophin 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-516s1c1
Sequence:CCGGGAGCCTGAAATCCGACTTCAACTCGAGTTGAAGTCGGATTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-957s1c1
Sequence:CCGGCTTTGAGACAAATCAGCTCATCTCGAGATGAGCTGATTTGTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153274.1-519s1c1
Sequence:CCGGCCTGAAATCCGACTTCAACAACTCGAGTTGTTGAAGTCGGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-669s1c1
Sequence:CCGGGCTATTCCACTATGACTGGATCTCGAGATCCAGTCATAGTGGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-795s1c1
Sequence:CCGGCAAACCTCAGAAGCTTCTGAACTCGAGTTCAGAAGCTTCTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-723s1c1
Sequence:CCGGCATAGCCGTCTACTCTTTCTTCTCGAGAAGAAAGAGTAGACGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153274.1-954s1c1
Sequence:CCGGCGACTTTGAGACAAATCAGCTCTCGAGAGCTGATTTGTCTCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153274.2-216s21c1
Sequence:CCGGAGGAGCAGAGGTACGTGTATGCTCGAGCATACACGTACCTCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153274.2-968s21c1
Sequence:CCGGGAACAGATCATCAACCCATTTCTCGAGAAATGGGTTGATGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153274.2-1851s21c1
Sequence:CCGGCATTTCTGGCACGTTAGATTTCTCGAGAAATCTAACGTGCCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153274
BEST4 MISSION shRNA shRNA Plasmid DNA
bestrophin 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-516s1c1
Sequence:CCGGGAGCCTGAAATCCGACTTCAACTCGAGTTGAAGTCGGATTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-957s1c1
Sequence:CCGGCTTTGAGACAAATCAGCTCATCTCGAGATGAGCTGATTTGTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153274.1-519s1c1
Sequence:CCGGCCTGAAATCCGACTTCAACAACTCGAGTTGTTGAAGTCGGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-669s1c1
Sequence:CCGGGCTATTCCACTATGACTGGATCTCGAGATCCAGTCATAGTGGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-795s1c1
Sequence:CCGGCAAACCTCAGAAGCTTCTGAACTCGAGTTCAGAAGCTTCTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-723s1c1
Sequence:CCGGCATAGCCGTCTACTCTTTCTTCTCGAGAAGAAAGAGTAGACGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153274.1-954s1c1
Sequence:CCGGCGACTTTGAGACAAATCAGCTCTCGAGAGCTGATTTGTCTCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153274.2-216s21c1
Sequence:CCGGAGGAGCAGAGGTACGTGTATGCTCGAGCATACACGTACCTCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153274.2-968s21c1
Sequence:CCGGGAACAGATCATCAACCCATTTCTCGAGAAATGGGTTGATGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153274.2-1851s21c1
Sequence:CCGGCATTTCTGGCACGTTAGATTTCTCGAGAAATCTAACGTGCCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153274
BEST4 MISSION shRNA Lentiviral Transduction Particles
bestrophin 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-516s1c1
Sequence:CCGGGAGCCTGAAATCCGACTTCAACTCGAGTTGAAGTCGGATTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-957s1c1
Sequence:CCGGCTTTGAGACAAATCAGCTCATCTCGAGATGAGCTGATTTGTCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153274.1-519s1c1
Sequence:CCGGCCTGAAATCCGACTTCAACAACTCGAGTTGTTGAAGTCGGATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-669s1c1
Sequence:CCGGGCTATTCCACTATGACTGGATCTCGAGATCCAGTCATAGTGGAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-795s1c1
Sequence:CCGGCAAACCTCAGAAGCTTCTGAACTCGAGTTCAGAAGCTTCTGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153274.1-723s1c1
Sequence:CCGGCATAGCCGTCTACTCTTTCTTCTCGAGAAGAAAGAGTAGACGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153274.1-954s1c1
Sequence:CCGGCGACTTTGAGACAAATCAGCTCTCGAGAGCTGATTTGTCTCAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153274.2-216s21c1
Sequence:CCGGAGGAGCAGAGGTACGTGTATGCTCGAGCATACACGTACCTCTGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153274.2-968s21c1
Sequence:CCGGGAACAGATCATCAACCCATTTCTCGAGAAATGGGTTGATGATCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153274.2-1851s21c1
Sequence:CCGGCATTTCTGGCACGTTAGATTTCTCGAGAAATCTAACGTGCCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks