EMAIL THIS PAGE TO A FRIEND

BET1

Bet1 golgi vesicular membrane trafficking protein

Synonyms: HBET1
UniProtKB ID: O15155
Gene ID:
Human(10282) Summary: This gene encodes a golgi-associated membrane protein that participates in vesicular transport from the endoplasmic reticulum (ER) to the Golgi complex. The encoded protein functions as a soluble N-ethylaleimide-sensitive factor attachment protein receptor and may be involved in the docking of ER-derived vesicles with the cis-Golgi membrane. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12068) blocked early in transport 1 homolog (S. cerevisiae)
Rat(29631) Bet1 golgi vesicular membrane trafficking protein
Zebrafish(415135) blocked early in transport 1 homolog (S. cerevisiae)
chicken(420563) blocked early in transport 1 homolog (S. cerevisiae)
fruit fly(40094) CG14084 gene product from transcript CG14084-RB
dog(475231) blocked early in transport 1 homolog (S. cerevisiae)
cow(616526) blocked early in transport 1 homolog (S. cerevisiae)
domestic cat(101089179) blocked early in transport 1 homolog (S. cerevisiae)
naked mole-rat(101721437) Bet1 golgi vesicular membrane trafficking protein
domestic guinea pig(100734462) Bet1 golgi vesicular membrane trafficking protein
sheep(101114348) blocked early in transport 1 homolog (S. cerevisiae)
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005868 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005868 Rosetta Predictions human pricing
NM_019251 Rosetta Predictions rat pricing
NM_009748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097117 predicted 752
2 SASI_Hs01_00097118 predicted 956
3 SASI_Hs01_00097119 predicted 435
4 SASI_Hs01_00097120 predicted 748
5 SASI_Hs01_00097121 predicted 678
6 SASI_Hs01_00097122 predicted 949
7 SASI_Hs01_00097123 predicted 201
8 SASI_Hs01_00097124 predicted 436
9 SASI_Hs01_00097125 predicted 225
10 SASI_Hs02_00340436 predicted 517
11 SASI_Hs01_00097116 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049896 predicted 433
2 SASI_Rn01_00049897 predicted 449
3 SASI_Rn01_00049898 predicted 781
4 SASI_Rn01_00049899 predicted 528
5 SASI_Rn01_00049900 predicted 356
6 SASI_Rn01_00049901 predicted 662
7 SASI_Rn01_00049902 predicted 591
8 SASI_Rn01_00049904 predicted 266
9 SASI_Rn01_00049905 predicted 722
10 SASI_Rn02_00262129 predicted 585
11 SASI_Rn01_00049903 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121862 predicted 250
2 SASI_Mm01_00121864 predicted 675
3 SASI_Mm01_00121865 predicted 484
4 SASI_Mm01_00121866 predicted 497
5 SASI_Mm01_00121867 predicted 611
6 SASI_Mm01_00121868 predicted 684
7 SASI_Mm01_00121869 predicted 573
8 SASI_Mm01_00121870 predicted 311
9 SASI_Mm01_00121871 predicted 318
10 SASI_Mm02_00316934 predicted 755
11 SASI_Mm01_00121863 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009748
VALIDATED
BET1 MISSION shRNA Bacterial Glycerol Stock
Bet1 golgi vesicular membrane trafficking protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-188s21c1
Sequence:CCGGGCTATGCCAATACTGGTTATACTCGAGTATAACCAGTATTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-325s21c1
Sequence:CCGGGCTGAAATGGATTCACAATTTCTCGAGAAATTGTGAATCCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-251s21c1
Sequence:CCGGGAAGCAAAGTAACGGCTATAACTCGAGTTATAGCCGTTACTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-374s21c1
Sequence:CCGGCCATGGGAAGACTGAAGATTTCTCGAGAAATCTTCAGTCTTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-188s1c1
Sequence:CCGGGCTATGCCAATACTGGTTATACTCGAGTATAACCAGTATTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-420s1c1
Sequence:CCGGGCTATGCTATATGATGCTGTTCTCGAGAACAGCATCATATAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009748.2-325s1c1
Sequence:CCGGGCTGAAATGGATTCACAATTTCTCGAGAAATTGTGAATCCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-374s1c1
Sequence:CCGGCCATGGGAAGACTGAAGATTTCTCGAGAAATCTTCAGTCTTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-251s1c1
Sequence:CCGGGAAGCAAAGTAACGGCTATAACTCGAGTTATAGCCGTTACTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009748
VALIDATED
BET1 MISSION shRNA shRNA Plasmid DNA
Bet1 golgi vesicular membrane trafficking protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-188s21c1
Sequence:CCGGGCTATGCCAATACTGGTTATACTCGAGTATAACCAGTATTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-325s21c1
Sequence:CCGGGCTGAAATGGATTCACAATTTCTCGAGAAATTGTGAATCCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-251s21c1
Sequence:CCGGGAAGCAAAGTAACGGCTATAACTCGAGTTATAGCCGTTACTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-374s21c1
Sequence:CCGGCCATGGGAAGACTGAAGATTTCTCGAGAAATCTTCAGTCTTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-188s1c1
Sequence:CCGGGCTATGCCAATACTGGTTATACTCGAGTATAACCAGTATTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-420s1c1
Sequence:CCGGGCTATGCTATATGATGCTGTTCTCGAGAACAGCATCATATAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009748.2-325s1c1
Sequence:CCGGGCTGAAATGGATTCACAATTTCTCGAGAAATTGTGAATCCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-374s1c1
Sequence:CCGGCCATGGGAAGACTGAAGATTTCTCGAGAAATCTTCAGTCTTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-251s1c1
Sequence:CCGGGAAGCAAAGTAACGGCTATAACTCGAGTTATAGCCGTTACTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009748
VALIDATED
BET1 MISSION shRNA Lentiviral Transduction Particles
Bet1 golgi vesicular membrane trafficking protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-188s21c1
Sequence:CCGGGCTATGCCAATACTGGTTATACTCGAGTATAACCAGTATTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-325s21c1
Sequence:CCGGGCTGAAATGGATTCACAATTTCTCGAGAAATTGTGAATCCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-251s21c1
Sequence:CCGGGAAGCAAAGTAACGGCTATAACTCGAGTTATAGCCGTTACTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009748.2-374s21c1
Sequence:CCGGCCATGGGAAGACTGAAGATTTCTCGAGAAATCTTCAGTCTTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-188s1c1
Sequence:CCGGGCTATGCCAATACTGGTTATACTCGAGTATAACCAGTATTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-420s1c1
Sequence:CCGGGCTATGCTATATGATGCTGTTCTCGAGAACAGCATCATATAGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009748.2-325s1c1
Sequence:CCGGGCTGAAATGGATTCACAATTTCTCGAGAAATTGTGAATCCATTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-374s1c1
Sequence:CCGGCCATGGGAAGACTGAAGATTTCTCGAGAAATCTTCAGTCTTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009748.2-251s1c1
Sequence:CCGGGAAGCAAAGTAACGGCTATAACTCGAGTTATAGCCGTTACTTTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005868
VALIDATED
BET1 MISSION shRNA Bacterial Glycerol Stock
Bet1 golgi vesicular membrane trafficking protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005868.4-518s1c1
Sequence:CCGGGATGCATGTAATTGTGAATTTCTCGAGAAATTCACAATTACATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.4-257s1c1
Sequence:CCGGATGAGAGGCTCACTGAAAGTCCTCGAGGACTTTCAGTGAGCCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-1066s1c1
Sequence:CCGGCCTCATTTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-380s1c1
Sequence:CCGGCCACAACTGGATTTCTAGGTACTCGAGTACCTAGAAATCCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005868.3-450s1c1
Sequence:CCGGGCTGTGCTATATGATGCTGTTCTCGAGAACAGCATCATATAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005868.3-835s1c1
Sequence:CCGGGCAGGTTTATGTCCCATGTAACTCGAGTTACATGGGACATAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-210s1c1
Sequence:CCGGGAACTATGGCTATGCTAATAGCTCGAGCTATTAGCATAGCCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-439s1c1
Sequence:CCGGCAAACAAAGCTGCTGTGCTATCTCGAGATAGCACAGCAGCTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-549s1c1
Sequence:CCGGCCAACTTAATGGCTTGCAGTACTCGAGTACTGCAAGCCATTAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-196s1c1
Sequence:CCGGCCTGGCAACTATGGGAACTATCTCGAGATAGTTCCCATAGTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005868
VALIDATED
BET1 MISSION shRNA shRNA Plasmid DNA
Bet1 golgi vesicular membrane trafficking protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005868.4-518s1c1
Sequence:CCGGGATGCATGTAATTGTGAATTTCTCGAGAAATTCACAATTACATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.4-257s1c1
Sequence:CCGGATGAGAGGCTCACTGAAAGTCCTCGAGGACTTTCAGTGAGCCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-1066s1c1
Sequence:CCGGCCTCATTTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-380s1c1
Sequence:CCGGCCACAACTGGATTTCTAGGTACTCGAGTACCTAGAAATCCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005868.3-450s1c1
Sequence:CCGGGCTGTGCTATATGATGCTGTTCTCGAGAACAGCATCATATAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005868.3-835s1c1
Sequence:CCGGGCAGGTTTATGTCCCATGTAACTCGAGTTACATGGGACATAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-210s1c1
Sequence:CCGGGAACTATGGCTATGCTAATAGCTCGAGCTATTAGCATAGCCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-439s1c1
Sequence:CCGGCAAACAAAGCTGCTGTGCTATCTCGAGATAGCACAGCAGCTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-549s1c1
Sequence:CCGGCCAACTTAATGGCTTGCAGTACTCGAGTACTGCAAGCCATTAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-196s1c1
Sequence:CCGGCCTGGCAACTATGGGAACTATCTCGAGATAGTTCCCATAGTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005868
VALIDATED
BET1 MISSION shRNA Lentiviral Transduction Particles
Bet1 golgi vesicular membrane trafficking protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219972    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005868.4-518s1c1
Sequence:CCGGGATGCATGTAATTGTGAATTTCTCGAGAAATTCACAATTACATGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.4-257s1c1
Sequence:CCGGATGAGAGGCTCACTGAAAGTCCTCGAGGACTTTCAGTGAGCCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156166    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-1066s1c1
Sequence:CCGGCCTCATTTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-380s1c1
Sequence:CCGGCCACAACTGGATTTCTAGGTACTCGAGTACCTAGAAATCCAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005868.3-450s1c1
Sequence:CCGGGCTGTGCTATATGATGCTGTTCTCGAGAACAGCATCATATAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005868.3-835s1c1
Sequence:CCGGGCAGGTTTATGTCCCATGTAACTCGAGTTACATGGGACATAAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-210s1c1
Sequence:CCGGGAACTATGGCTATGCTAATAGCTCGAGCTATTAGCATAGCCATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-439s1c1
Sequence:CCGGCAAACAAAGCTGCTGTGCTATCTCGAGATAGCACAGCAGCTTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_005868.3-549s1c1
Sequence:CCGGCCAACTTAATGGCTTGCAGTACTCGAGTACTGCAAGCCATTAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005868.3-196s1c1
Sequence:CCGGCCTGGCAACTATGGGAACTATCTCGAGATAGTTCCCATAGTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks