EMAIL THIS PAGE TO A FRIEND

BET1L

Bet1 golgi vesicular membrane trafficking protein-like

Synonyms: BET1L1 GOLIM3 GS15 HSPC197
UniProtKB ID: Q9NYM9, B3KMY0
Gene ID:
Mouse(54399) blocked early in transport 1 homolog (S. cerevisiae)-like
Rat(54400) Bet1 golgi vesicular membrane trafficking protein-like
Zebrafish(445493) blocked early in transport 1 homolog (S. cerevisiae)-like
cow(509758) blocked early in transport 1 homolog (S. cerevisiae)-like
domestic cat(101081001) blocked early in transport 1 homolog (S. cerevisiae)-like
dog(483393) blocked early in transport 1 homolog (S. cerevisiae)-like
chicken(422985) blocked early in transport 1 homolog (S. cerevisiae)-like
sheep(101105700) blocked early in transport 1 homolog (S. cerevisiae)-like
domestic guinea pig(100731686) Bet1 golgi vesicular membrane trafficking protein-like
naked mole-rat(101698747) Bet1 golgi vesicular membrane trafficking protein-like
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA039819 Anti-BET1L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016526 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114341 MISSION® esiRNA esiRNA human BET1L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098787 Rosetta Predictions human pricing
NM_016526 Rosetta Predictions human pricing
NM_019368 Rosetta Predictions rat pricing
NM_018742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319829 predicted 897
2 SASI_Hs02_00319830 predicted 373
3 SASI_Hs02_00319831 predicted 524
4 SASI_Hs02_00319832 predicted 327
5 SASI_Hs02_00319833 predicted 264
6 SASI_Hs02_00319834 predicted 365
7 SASI_Hs02_00319835 predicted 823
8 SASI_Hs02_00319836 predicted 230
9 SASI_Hs02_00319837 predicted 183
10 SASI_Hs02_00319838 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113567 predicted 514
2 SASI_Hs01_00113568 predicted 381
3 SASI_Hs01_00113570 predicted 501
4 SASI_Hs01_00113571 predicted 232
5 SASI_Hs01_00113572 predicted 179
6 SASI_Hs01_00113573 predicted 196
7 SASI_Hs01_00113574 predicted 132
8 SASI_Hs01_00113576 predicted 400
9 SASI_Hs02_00349627 predicted 745
10 SASI_Hs02_00349628 predicted 737
11 SASI_Hs01_00113569 predicted 629
12 SASI_Hs01_00113575 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054311 predicted 733
2 SASI_Rn01_00054312 predicted 762
3 SASI_Rn01_00054313 predicted 317
4 SASI_Rn01_00054314 predicted 304
5 SASI_Rn01_00054316 predicted 207
6 SASI_Rn01_00054317 predicted 650
7 SASI_Rn01_00054318 predicted 439
8 SASI_Rn01_00054320 predicted 865
9 SASI_Rn02_00262387 predicted 320
10 SASI_Rn02_00262388 predicted 439
11 SASI_Rn01_00054315 predicted 664
12 SASI_Rn01_00054319 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323994 predicted 934
2 SASI_Mm02_00323995 predicted 847
3 SASI_Mm01_00073117 predicted 244
4 SASI_Mm02_00323996 predicted 944
5 SASI_Mm01_00073122 predicted 227
6 SASI_Mm02_00323997 predicted 782
7 SASI_Mm02_00323998 predicted 836
8 SASI_Mm02_00323999 predicted 305
9 SASI_Mm02_00324000 predicted 252
10 SASI_Mm02_00324001 predicted 230
11 SASI_Mm01_00073116 predicted 286
12 SASI_Mm01_00073118 predicted 406
13 SASI_Mm01_00073119 predicted 514
14 SASI_Mm01_00073120 predicted 644
15 SASI_Mm01_00073121 predicted 294
16 SASI_Mm01_00073123 predicted 743
17 SASI_Mm01_00073124 predicted 277
18 SASI_Mm01_00073125 predicted 161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018742
BET1L MISSION shRNA Bacterial Glycerol Stock
Bet1 golgi vesicular membrane trafficking protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018742.3-820s1c1
Sequence:CCGGCCTCTCCAGATGATGGTCATTCTCGAGAATGACCATCATCTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-337s1c1
Sequence:CCGGCCTACCTCTTGTCGAGTACAACTCGAGTTGTACTCGACAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-168s1c1
Sequence:CCGGGAGGACCAGAACCGTTACTTACTCGAGTAAGTAACGGTTCTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-193s1c1
Sequence:CCGGGCATGGACTCAGATTTCACAACTCGAGTTGTGAAATCTGAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-128s1c1
Sequence:CCGGCAGGCTTAAATCGCTGGCTTTCTCGAGAAAGCCAGCGATTTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018742
BET1L MISSION shRNA shRNA Plasmid DNA
Bet1 golgi vesicular membrane trafficking protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018742.3-820s1c1
Sequence:CCGGCCTCTCCAGATGATGGTCATTCTCGAGAATGACCATCATCTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-337s1c1
Sequence:CCGGCCTACCTCTTGTCGAGTACAACTCGAGTTGTACTCGACAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-168s1c1
Sequence:CCGGGAGGACCAGAACCGTTACTTACTCGAGTAAGTAACGGTTCTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-193s1c1
Sequence:CCGGGCATGGACTCAGATTTCACAACTCGAGTTGTGAAATCTGAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-128s1c1
Sequence:CCGGCAGGCTTAAATCGCTGGCTTTCTCGAGAAAGCCAGCGATTTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018742
BET1L MISSION shRNA Lentiviral Transduction Particles
Bet1 golgi vesicular membrane trafficking protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018742.3-820s1c1
Sequence:CCGGCCTCTCCAGATGATGGTCATTCTCGAGAATGACCATCATCTGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-337s1c1
Sequence:CCGGCCTACCTCTTGTCGAGTACAACTCGAGTTGTACTCGACAAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-168s1c1
Sequence:CCGGGAGGACCAGAACCGTTACTTACTCGAGTAAGTAACGGTTCTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-193s1c1
Sequence:CCGGGCATGGACTCAGATTTCACAACTCGAGTTGTGAAATCTGAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018742.3-128s1c1
Sequence:CCGGCAGGCTTAAATCGCTGGCTTTCTCGAGAAAGCCAGCGATTTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016526
VALIDATED
BET1L MISSION shRNA Bacterial Glycerol Stock
Bet1 golgi vesicular membrane trafficking protein-like
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-319s1c1
Sequence:CCGGTGGGTGGTCAAATCACCACTTCTCGAGAAGTGGTGATTTGACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-176s1c1
Sequence:CCGGGCCCTGGACATCGATAGGGATCTCGAGATCCCTATCGATGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-116s1c1
Sequence:CCGGCGGGAGAACAAGCGAATGGCTCTCGAGAGCCATTCGCTTGTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_016526.3-212s1c1
Sequence:CCGGCGGTACCTGGATGGCATGGTACTCGAGTACCATGCCATCCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-340s1c1
Sequence:CCGGCTGTGTGATCTTGCTGGGATTCTCGAGAATCCCAGCAAGATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-372s21c1
Sequence:GTACCGGCACCACTTCTGTGTGATCTTGCTCGAGCAAGATCACACAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-353s21c1
Sequence:GTACCGGTGCGGGTGGGTGGTCAAATCACTCGAGTGATTTGACCACCCACCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-488s21c1
Sequence:GTACCGGAGACAACCGGAAGCTTCTATGCTCGAGCATAGAAGCTTCCGGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-176s21c1
Sequence:GTACCGGTGACAGCCTGGCCTCCAAAGTCTCGAGACTTTGGAGGCCAGGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-510s21c1
Sequence:GTACCGGGGCATGGCCGTGGGTCTAATTCTCGAGAATTAGACCCACGGCCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-736s21c1
Sequence:GTACCGGGTGACCTGATGAGCTCATGTTCTCGAGAACATGAGCTCATCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-161s21c1
Sequence:GTACCGGGAACAAGCGAATGGCTGACAGCTCGAGCTGTCAGCCATTCGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016526
VALIDATED
BET1L MISSION shRNA shRNA Plasmid DNA
Bet1 golgi vesicular membrane trafficking protein-like
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-319s1c1
Sequence:CCGGTGGGTGGTCAAATCACCACTTCTCGAGAAGTGGTGATTTGACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-176s1c1
Sequence:CCGGGCCCTGGACATCGATAGGGATCTCGAGATCCCTATCGATGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-116s1c1
Sequence:CCGGCGGGAGAACAAGCGAATGGCTCTCGAGAGCCATTCGCTTGTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_016526.3-212s1c1
Sequence:CCGGCGGTACCTGGATGGCATGGTACTCGAGTACCATGCCATCCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-340s1c1
Sequence:CCGGCTGTGTGATCTTGCTGGGATTCTCGAGAATCCCAGCAAGATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-372s21c1
Sequence:GTACCGGCACCACTTCTGTGTGATCTTGCTCGAGCAAGATCACACAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-353s21c1
Sequence:GTACCGGTGCGGGTGGGTGGTCAAATCACTCGAGTGATTTGACCACCCACCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-488s21c1
Sequence:GTACCGGAGACAACCGGAAGCTTCTATGCTCGAGCATAGAAGCTTCCGGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-176s21c1
Sequence:GTACCGGTGACAGCCTGGCCTCCAAAGTCTCGAGACTTTGGAGGCCAGGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-510s21c1
Sequence:GTACCGGGGCATGGCCGTGGGTCTAATTCTCGAGAATTAGACCCACGGCCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-736s21c1
Sequence:GTACCGGGTGACCTGATGAGCTCATGTTCTCGAGAACATGAGCTCATCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-161s21c1
Sequence:GTACCGGGAACAAGCGAATGGCTGACAGCTCGAGCTGTCAGCCATTCGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016526
VALIDATED
BET1L MISSION shRNA Lentiviral Transduction Particles
Bet1 golgi vesicular membrane trafficking protein-like
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-319s1c1
Sequence:CCGGTGGGTGGTCAAATCACCACTTCTCGAGAAGTGGTGATTTGACCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-176s1c1
Sequence:CCGGGCCCTGGACATCGATAGGGATCTCGAGATCCCTATCGATGTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-116s1c1
Sequence:CCGGCGGGAGAACAAGCGAATGGCTCTCGAGAGCCATTCGCTTGTTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_016526.3-212s1c1
Sequence:CCGGCGGTACCTGGATGGCATGGTACTCGAGTACCATGCCATCCAGGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016526.3-340s1c1
Sequence:CCGGCTGTGTGATCTTGCTGGGATTCTCGAGAATCCCAGCAAGATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-372s21c1
Sequence:GTACCGGCACCACTTCTGTGTGATCTTGCTCGAGCAAGATCACACAGAAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-353s21c1
Sequence:GTACCGGTGCGGGTGGGTGGTCAAATCACTCGAGTGATTTGACCACCCACCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-488s21c1
Sequence:GTACCGGAGACAACCGGAAGCTTCTATGCTCGAGCATAGAAGCTTCCGGTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-176s21c1
Sequence:GTACCGGTGACAGCCTGGCCTCCAAAGTCTCGAGACTTTGGAGGCCAGGCTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379679    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-510s21c1
Sequence:GTACCGGGGCATGGCCGTGGGTCTAATTCTCGAGAATTAGACCCACGGCCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016526.4-736s21c1
Sequence:GTACCGGGTGACCTGATGAGCTCATGTTCTCGAGAACATGAGCTCATCAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016526.4-161s21c1
Sequence:GTACCGGGAACAAGCGAATGGCTGACAGCTCGAGCTGTCAGCCATTCGCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks