EMAIL THIS PAGE TO A FRIEND

BEX2

brain expressed X-linked 2

Synonyms: BEX1 DJ79P11.1
UniProtKB ID: Q9BXY8, B2R574, D3DXA2, F5H7H5, Q5JVV9
Gene ID:
Human(84707) Summary: This gene belongs to the brain expressed X-linked gene family. The encoded protein interacts with the transcription factor LIM domain only 2 in a DNA-binding complex that recognizes the E-box element and promotes transcription. This gene has been found to be a tumor suppressor that is silenced in human glioma. In breast cancer cells, this gene product modulates apoptosis in response to estrogen and tamoxifen, and enhances the anti-proliferative effect of tamoxifen. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(12069) brain expressed X-linked 2
Rat(363498) brain expressed X-linked 2
sheep(101118422) brain expressed X-linked 2
cow(767968) brain expressed X-linked 2
cow(768028) brain expressed X-linked 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032621 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032621 Rosetta Predictions human pricing
NM_001077435 Rosetta Predictions rat pricing
NM_009749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227629 predicted 420
2 SASI_Hs01_00227630 predicted 428
3 SASI_Hs01_00227631 predicted 251
4 SASI_Hs01_00227632 predicted 250
5 SASI_Hs01_00227633 predicted 250
6 SASI_Hs01_00227635 predicted 439
7 SASI_Hs01_00227636 predicted 252
8 SASI_Hs01_00227637 predicted 347
9 SASI_Hs01_00227638 predicted 243
10 SASI_Hs02_00360172 predicted 439
11 SASI_Hs01_00227634 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207552 predicted 249
2 SASI_Rn02_00207553 predicted 248
3 SASI_Rn02_00207554 predicted 280
4 SASI_Rn02_00207555 predicted 419
5 SASI_Rn02_00207556 predicted 242
6 SASI_Rn02_00207557 predicted 241
7 SASI_Rn02_00207558 predicted 738
8 SASI_Rn02_00207559 predicted 732
9 SASI_Rn02_00207560 predicted 576
10 SASI_Rn02_00207561 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072434 predicted 253
2 SASI_Mm01_00072435 predicted 235
3 SASI_Mm01_00072436 predicted 241
4 SASI_Mm01_00072438 predicted 280
5 SASI_Mm01_00072440 predicted 263
6 SASI_Mm01_00072441 predicted 732
7 SASI_Mm01_00072442 predicted 570
8 SASI_Mm01_00072443 predicted 722
9 SASI_Mm02_00316935 predicted 588
10 SASI_Mm02_00316936 predicted 735
11 SASI_Mm01_00072437 predicted 280
12 SASI_Mm01_00072439 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009749
VALIDATED
BEX2 MISSION shRNA Bacterial Glycerol Stock
brain expressed X-linked 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009749.1-584s1c1
Sequence:CCGGGTTTGTGATGTACTGTTGTAACTCGAGTTACAACAGTACATCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009749.1-274s21c1
Sequence:CCGGGACTACTACGTGCCTAGAGGACTCGAGTCCTCTAGGCACGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009749.1-247s21c1
Sequence:CCGGATTGTGGCCCTGCCTTTCGAACTCGAGTTCGAAAGGCAGGGCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009749.1-262s21c1
Sequence:CCGGTTCGAAGCTGGAGACTACTACCTCGAGGTAGTAGTCTCCAGCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009749.1-587s21c1
Sequence:CCGGTGTGATGTACTGTTGTAATATCTCGAGATATTACAACAGTACATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009749
VALIDATED
BEX2 MISSION shRNA shRNA Plasmid DNA
brain expressed X-linked 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009749.1-584s1c1
Sequence:CCGGGTTTGTGATGTACTGTTGTAACTCGAGTTACAACAGTACATCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009749.1-274s21c1
Sequence:CCGGGACTACTACGTGCCTAGAGGACTCGAGTCCTCTAGGCACGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009749.1-247s21c1
Sequence:CCGGATTGTGGCCCTGCCTTTCGAACTCGAGTTCGAAAGGCAGGGCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009749.1-262s21c1
Sequence:CCGGTTCGAAGCTGGAGACTACTACCTCGAGGTAGTAGTCTCCAGCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009749.1-587s21c1
Sequence:CCGGTGTGATGTACTGTTGTAATATCTCGAGATATTACAACAGTACATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009749
VALIDATED
BEX2 MISSION shRNA Lentiviral Transduction Particles
brain expressed X-linked 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009749.1-584s1c1
Sequence:CCGGGTTTGTGATGTACTGTTGTAACTCGAGTTACAACAGTACATCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009749.1-274s21c1
Sequence:CCGGGACTACTACGTGCCTAGAGGACTCGAGTCCTCTAGGCACGTAGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009749.1-247s21c1
Sequence:CCGGATTGTGGCCCTGCCTTTCGAACTCGAGTTCGAAAGGCAGGGCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009749.1-262s21c1
Sequence:CCGGTTCGAAGCTGGAGACTACTACCTCGAGGTAGTAGTCTCCAGCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265308    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009749.1-587s21c1
Sequence:CCGGTGTGATGTACTGTTGTAATATCTCGAGATATTACAACAGTACATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032621
VALIDATED
BEX2 MISSION shRNA Bacterial Glycerol Stock
brain expressed X-linked 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-451s1c1
Sequence:CCGGCCATGACCATCACGATGAGTTCTCGAGAACTCATCGTGATGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-208s1c1
Sequence:CCGGCTTGGCCCTACCTTTGAATGTCTCGAGACATTCAAAGGTAGGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-212s1c1
Sequence:CCGGGCCCTACCTTTGAATGTTAGTCTCGAGACTAACATTCAAAGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-218s1c1
Sequence:CCGGCCTTTGAATGTTAGTGAATACCTCGAGGTATTCACTAACATTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-457s21c1
Sequence:CCGGGCAGTATAGATGGGACATAATCTCGAGATTATGTCCCATCTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-649s21c1
Sequence:CCGGGCCCTGAATCCTGATGGTTTCCTCGAGGAAACCATCAGGATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-500s21c1
Sequence:CCGGGCAAGGATGAGAGAGGAGAATCTCGAGATTCTCCTCTCTCATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-540s21c1
Sequence:CCGGAGGTGAGACAGCTGATGGAAACTCGAGTTTCCATCAGCTGTCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-472s21c1
Sequence:CCGGCATAATGCATAGGCTTGGAGACTCGAGTCTCCAAGCCTATGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032621
VALIDATED
BEX2 MISSION shRNA shRNA Plasmid DNA
brain expressed X-linked 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-451s1c1
Sequence:CCGGCCATGACCATCACGATGAGTTCTCGAGAACTCATCGTGATGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-208s1c1
Sequence:CCGGCTTGGCCCTACCTTTGAATGTCTCGAGACATTCAAAGGTAGGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-212s1c1
Sequence:CCGGGCCCTACCTTTGAATGTTAGTCTCGAGACTAACATTCAAAGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-218s1c1
Sequence:CCGGCCTTTGAATGTTAGTGAATACCTCGAGGTATTCACTAACATTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-457s21c1
Sequence:CCGGGCAGTATAGATGGGACATAATCTCGAGATTATGTCCCATCTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-649s21c1
Sequence:CCGGGCCCTGAATCCTGATGGTTTCCTCGAGGAAACCATCAGGATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-500s21c1
Sequence:CCGGGCAAGGATGAGAGAGGAGAATCTCGAGATTCTCCTCTCTCATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-540s21c1
Sequence:CCGGAGGTGAGACAGCTGATGGAAACTCGAGTTTCCATCAGCTGTCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-472s21c1
Sequence:CCGGCATAATGCATAGGCTTGGAGACTCGAGTCTCCAAGCCTATGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032621
VALIDATED
BEX2 MISSION shRNA Lentiviral Transduction Particles
brain expressed X-linked 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-451s1c1
Sequence:CCGGCCATGACCATCACGATGAGTTCTCGAGAACTCATCGTGATGGTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-208s1c1
Sequence:CCGGCTTGGCCCTACCTTTGAATGTCTCGAGACATTCAAAGGTAGGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-212s1c1
Sequence:CCGGGCCCTACCTTTGAATGTTAGTCTCGAGACTAACATTCAAAGGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032621.1-218s1c1
Sequence:CCGGCCTTTGAATGTTAGTGAATACCTCGAGGTATTCACTAACATTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-457s21c1
Sequence:CCGGGCAGTATAGATGGGACATAATCTCGAGATTATGTCCCATCTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-649s21c1
Sequence:CCGGGCCCTGAATCCTGATGGTTTCCTCGAGGAAACCATCAGGATTCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-500s21c1
Sequence:CCGGGCAAGGATGAGAGAGGAGAATCTCGAGATTCTCCTCTCTCATCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-540s21c1
Sequence:CCGGAGGTGAGACAGCTGATGGAAACTCGAGTTTCCATCAGCTGTCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032621.3-472s21c1
Sequence:CCGGCATAATGCATAGGCTTGGAGACTCGAGTCTCCAAGCCTATGCATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks