EMAIL THIS PAGE TO A FRIEND

BEX4

brain expressed, X-linked 4

112 Gene Product Result for
Synonyms: BEXL1
UniProtKB ID: Q9NWD9
Gene ID:
Human(56271) Summary: This gene is a member of the brain expressed X-linked gene family. The proteins encoded by some of the other members of this family act as transcription elongation factors which allow RNA polymerase II to escape pausing during elongation. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2011]
Mouse(406217) brain expressed gene 4
Rat(501624) brain expressed, X-linked 4
cow(783451) brain expressed, X-linked 4
dog(492030) brain expressed, X-linked 4
sheep(101119115) brain expressed, X-linked 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080425 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080425 Rosetta Predictions human pricing
NM_001127688 Rosetta Predictions human pricing
XM_043653 Rosetta Predictions human pricing
NM_001037554 Rosetta Predictions rat pricing
XM_001053534 Rosetta Predictions rat pricing
NM_212457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314726 predicted 533
2 SASI_Hs02_00314727 predicted 450
3 SASI_Hs02_00314728 predicted 418
4 SASI_Hs02_00314729 predicted 462
5 SASI_Hs02_00314730 predicted 630
6 SASI_Hs02_00314731 predicted 634
7 SASI_Hs02_00314732 predicted 432
8 SASI_Hs02_00314733 predicted 505
9 SASI_Hs02_00314734 predicted 555
10 SASI_Hs02_00314735 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330134 predicted 442
2 SASI_Hs02_00330135 predicted 370
3 SASI_Hs02_00330136 predicted 343
4 SASI_Hs02_00330137 predicted 374
5 SASI_Hs02_00330138 predicted 541
6 SASI_Hs02_00330139 predicted 545
7 SASI_Hs02_00330140 predicted 346
8 SASI_Hs02_00330141 predicted 424
9 SASI_Hs02_00330142 predicted 471
10 SASI_Hs02_00330143 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_043653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254197 predicted 1092
2 SASI_Hs01_00254198 predicted 1066
3 SASI_Hs01_00254199 predicted 1088
4 SASI_Hs01_00254200 predicted 1083
5 SASI_Hs01_00254201 predicted 1091
6 SASI_Hs01_00254202 predicted 1066
7 SASI_Hs01_00254203 predicted 1090
8 SASI_Hs01_00254204 predicted 1069
9 SASI_Hs01_00254205 predicted 1079
10 SASI_Hs01_00254206 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204498 predicted 376
2 SASI_Rn01_00054262 predicted 425
3 SASI_Rn01_00054263 predicted 459
4 SASI_Rn01_00054264 predicted 368
5 SASI_Rn02_00204499 predicted 315
6 SASI_Rn01_00054265 predicted 306
7 SASI_Rn01_00054266 predicted 296
8 SASI_Rn01_00054267 predicted 366
9 SASI_Rn01_00054268 predicted 451
10 SASI_Rn01_00054269 predicted 439
11 SASI_Rn01_00054261 predicted 218
12 SASI_Rn01_00054270 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272653 predicted 359
2 SASI_Rn02_00272654 predicted 295
3 SASI_Rn02_00272655 predicted 303
4 SASI_Rn02_00272656 predicted 317
5 SASI_Rn02_00272657 predicted 349
6 SASI_Rn02_00272658 predicted 327
7 SASI_Rn02_00272659 predicted 202
8 SASI_Rn02_00272660 predicted 259
9 SASI_Rn02_00272661 predicted 348
10 SASI_Rn02_00272662 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146310 predicted 493
2 SASI_Mm01_00146311 predicted 283
3 SASI_Mm01_00146312 predicted 208
4 SASI_Mm01_00146314 predicted 379
5 SASI_Mm01_00146315 predicted 402
6 SASI_Mm01_00146316 predicted 210
7 SASI_Mm01_00146317 predicted 377
8 SASI_Mm01_00146318 predicted 525
9 SASI_Mm02_00352275 predicted 402
10 SASI_Mm02_00352276 predicted 220
11 SASI_Mm01_00146313 predicted 307
12 SASI_Mm01_00146319 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212457
BEX4 MISSION shRNA Bacterial Glycerol Stock
brain expressed, X-linked 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212457.2-601s21c1
Sequence:CCGGTTTACAAGCTCTTATCAAGTGCTCGAGCACTTGATAAGAGCTTGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-401s21c1
Sequence:CCGGATAGGCATGTTGATCGCAATGCTCGAGCATTGCGATCAACATGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-545s21c1
Sequence:CCGGTTTGCCTCATACCTTGAAATCCTCGAGGATTTCAAGGTATGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-521s21c1
Sequence:CCGGCGGAACCTGACAATCATTACGCTCGAGCGTAATGATTGTCAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212457
BEX4 MISSION shRNA shRNA Plasmid DNA
brain expressed, X-linked 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212457.2-601s21c1
Sequence:CCGGTTTACAAGCTCTTATCAAGTGCTCGAGCACTTGATAAGAGCTTGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-401s21c1
Sequence:CCGGATAGGCATGTTGATCGCAATGCTCGAGCATTGCGATCAACATGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-545s21c1
Sequence:CCGGTTTGCCTCATACCTTGAAATCCTCGAGGATTTCAAGGTATGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-521s21c1
Sequence:CCGGCGGAACCTGACAATCATTACGCTCGAGCGTAATGATTGTCAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212457
BEX4 MISSION shRNA Lentiviral Transduction Particles
brain expressed, X-linked 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212457.2-601s21c1
Sequence:CCGGTTTACAAGCTCTTATCAAGTGCTCGAGCACTTGATAAGAGCTTGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-401s21c1
Sequence:CCGGATAGGCATGTTGATCGCAATGCTCGAGCATTGCGATCAACATGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-545s21c1
Sequence:CCGGTTTGCCTCATACCTTGAAATCCTCGAGGATTTCAAGGTATGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212457.2-521s21c1
Sequence:CCGGCGGAACCTGACAATCATTACGCTCGAGCGTAATGATTGTCAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080425
VALIDATED
BEX4 MISSION shRNA Bacterial Glycerol Stock
brain expressed, X-linked 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080425.2-428s21c1
Sequence:CCGGGCCATACCTAATAGGCATATTCTCGAGAATATGCCTATTAGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-558s21c1
Sequence:CCGGCTGAACCTGACAACCATTATGCTCGAGCATAATGGTTGTCAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-400s21c1
Sequence:CCGGTAGGCGACTTGTCCCTAATTTCTCGAGAAATTAGGGACAAGTCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-763s21c1
Sequence:CCGGAGCATGGCAATTCACCTATTTCTCGAGAAATAGGTGAATTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-523s21c1
Sequence:CCGGACAGCAGATGAGGCACTATATCTCGAGATATAGTGCCTCATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080425
VALIDATED
BEX4 MISSION shRNA shRNA Plasmid DNA
brain expressed, X-linked 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080425.2-428s21c1
Sequence:CCGGGCCATACCTAATAGGCATATTCTCGAGAATATGCCTATTAGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-558s21c1
Sequence:CCGGCTGAACCTGACAACCATTATGCTCGAGCATAATGGTTGTCAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-400s21c1
Sequence:CCGGTAGGCGACTTGTCCCTAATTTCTCGAGAAATTAGGGACAAGTCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-763s21c1
Sequence:CCGGAGCATGGCAATTCACCTATTTCTCGAGAAATAGGTGAATTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-523s21c1
Sequence:CCGGACAGCAGATGAGGCACTATATCTCGAGATATAGTGCCTCATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080425
VALIDATED
BEX4 MISSION shRNA Lentiviral Transduction Particles
brain expressed, X-linked 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080425.2-428s21c1
Sequence:CCGGGCCATACCTAATAGGCATATTCTCGAGAATATGCCTATTAGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-558s21c1
Sequence:CCGGCTGAACCTGACAACCATTATGCTCGAGCATAATGGTTGTCAGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-400s21c1
Sequence:CCGGTAGGCGACTTGTCCCTAATTTCTCGAGAAATTAGGGACAAGTCGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-763s21c1
Sequence:CCGGAGCATGGCAATTCACCTATTTCTCGAGAAATAGGTGAATTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080425.2-523s21c1
Sequence:CCGGACAGCAGATGAGGCACTATATCTCGAGATATAGTGCCTCATCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks