EMAIL THIS PAGE TO A FRIEND

BFAR

bifunctional apoptosis regulator

75 Gene Product Result for
Synonyms: BAR RNF47
UniProtKB ID: Q9NZS9, A8K4Z9, D3DUG8
Gene ID:
Mouse(67118) bifunctional apoptosis regulator
Rat(304709) bifunctional apoptosis regulator
chicken(416424) bifunctional apoptosis regulator
domestic cat(101099768) bifunctional apoptosis regulator
cow(504902) bifunctional apoptosis regulator
Horse(100050577) bifunctional apoptosis regulator
dog(489998) bifunctional apoptosis regulator
naked mole-rat(101714555) bifunctional apoptosis regulator
domestic guinea pig(100732611) bifunctional apoptosis regulator
sheep(101112619) bifunctional apoptosis regulator
Domestic Rabbit(100351740) bifunctional apoptosis regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025976 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025976 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025976 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016561 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016561 Rosetta Predictions human pricing
NM_001013125 Rosetta Predictions rat pricing
NM_025976 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139892 predicted 1166
2 SASI_Hs01_00139893 predicted 1013
3 SASI_Hs01_00139896 predicted 684
4 SASI_Hs01_00139897 predicted 1334
5 SASI_Hs01_00139898 predicted 881
6 SASI_Hs01_00139899 predicted 229
7 SASI_Hs01_00139900 predicted 449
8 SASI_Hs01_00139901 predicted 222
9 SASI_Hs02_00349688 predicted 771
10 SASI_Hs02_00349689 predicted 1228
11 SASI_Hs01_00139894 predicted 326
12 SASI_Hs01_00139895 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095137 predicted 449
2 SASI_Rn01_00095138 predicted 219
3 SASI_Rn01_00095139 predicted 905
4 SASI_Rn01_00095140 predicted 1485
5 SASI_Rn01_00095141 predicted 764
6 SASI_Rn01_00095142 predicted 1422
7 SASI_Rn01_00095144 predicted 1022
8 SASI_Rn01_00095145 predicted 592
9 SASI_Rn01_00095146 predicted 252
10 SASI_Rn02_00200834 predicted 621
11 SASI_Rn01_00095143 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190424 predicted 653
2 SASI_Mm01_00190425 predicted 587
3 SASI_Mm01_00190426 predicted 1514
4 SASI_Mm01_00190428 predicted 576
5 SASI_Mm01_00190430 predicted 1089
6 SASI_Mm01_00190431 predicted 1563
7 SASI_Mm02_00329395 predicted 910
8 SASI_Mm02_00329396 predicted 609
9 SASI_Mm02_00329397 predicted 769
10 SASI_Mm02_00329398 predicted 650
11 SASI_Mm01_00190427 predicted 928
12 SASI_Mm01_00190429 predicted 232
13 SASI_Mm01_00190432 predicted 836
14 SASI_Mm01_00190433 predicted 329
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025976
VALIDATED
BFAR MISSION shRNA Bacterial Glycerol Stock
bifunctional apoptosis regulator
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-724s21c1
Sequence:CCGGCCGGTGTTCTCACAGCTTTAACTCGAGTTAAAGCTGTGAGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-579s21c1
Sequence:CCGGGCCATTAGAATGCGAGTTGAACTCGAGTTCAACTCGCATTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-753s21c1
Sequence:CCGGGCAGTCATCCTGCTTGTGTATCTCGAGATACACAAGCAGGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-639s21c1
Sequence:CCGGGCCTTTCAGAAATATGGGAATCTCGAGATTCCCATATTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-1563s21c1
Sequence:CCGGGCTCTGTACTTCAACCCAATTCTCGAGAATTGGGTTGAAGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025976.1-452s1c1
Sequence:CCGGGCCATTAGAATGCGAGTTGAACTCGAGTTCAACTCGCATTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-1436s1c1
Sequence:CCGGGCTCTGTACTTCAACCCAATTCTCGAGAATTGGGTTGAAGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-597s1c1
Sequence:CCGGCCGGTGTTCTCACAGCTTTAACTCGAGTTAAAGCTGTGAGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-626s1c1
Sequence:CCGGGCAGTCATCCTGCTTGTGTATCTCGAGATACACAAGCAGGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025976.1-512s1c1
Sequence:CCGGGCCTTTCAGAAATATGGGAATCTCGAGATTCCCATATTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025976
VALIDATED
BFAR MISSION shRNA shRNA Plasmid DNA
bifunctional apoptosis regulator
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-724s21c1
Sequence:CCGGCCGGTGTTCTCACAGCTTTAACTCGAGTTAAAGCTGTGAGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-579s21c1
Sequence:CCGGGCCATTAGAATGCGAGTTGAACTCGAGTTCAACTCGCATTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-753s21c1
Sequence:CCGGGCAGTCATCCTGCTTGTGTATCTCGAGATACACAAGCAGGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-639s21c1
Sequence:CCGGGCCTTTCAGAAATATGGGAATCTCGAGATTCCCATATTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-1563s21c1
Sequence:CCGGGCTCTGTACTTCAACCCAATTCTCGAGAATTGGGTTGAAGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025976.1-452s1c1
Sequence:CCGGGCCATTAGAATGCGAGTTGAACTCGAGTTCAACTCGCATTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-1436s1c1
Sequence:CCGGGCTCTGTACTTCAACCCAATTCTCGAGAATTGGGTTGAAGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-597s1c1
Sequence:CCGGCCGGTGTTCTCACAGCTTTAACTCGAGTTAAAGCTGTGAGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-626s1c1
Sequence:CCGGGCAGTCATCCTGCTTGTGTATCTCGAGATACACAAGCAGGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025976.1-512s1c1
Sequence:CCGGGCCTTTCAGAAATATGGGAATCTCGAGATTCCCATATTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025976
VALIDATED
BFAR MISSION shRNA Lentiviral Transduction Particles
bifunctional apoptosis regulator
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-724s21c1
Sequence:CCGGCCGGTGTTCTCACAGCTTTAACTCGAGTTAAAGCTGTGAGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-579s21c1
Sequence:CCGGGCCATTAGAATGCGAGTTGAACTCGAGTTCAACTCGCATTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-753s21c1
Sequence:CCGGGCAGTCATCCTGCTTGTGTATCTCGAGATACACAAGCAGGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-639s21c1
Sequence:CCGGGCCTTTCAGAAATATGGGAATCTCGAGATTCCCATATTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025976.4-1563s21c1
Sequence:CCGGGCTCTGTACTTCAACCCAATTCTCGAGAATTGGGTTGAAGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025976.1-452s1c1
Sequence:CCGGGCCATTAGAATGCGAGTTGAACTCGAGTTCAACTCGCATTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-1436s1c1
Sequence:CCGGGCTCTGTACTTCAACCCAATTCTCGAGAATTGGGTTGAAGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-597s1c1
Sequence:CCGGCCGGTGTTCTCACAGCTTTAACTCGAGTTAAAGCTGTGAGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025976.1-626s1c1
Sequence:CCGGGCAGTCATCCTGCTTGTGTATCTCGAGATACACAAGCAGGATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025976.1-512s1c1
Sequence:CCGGGCCTTTCAGAAATATGGGAATCTCGAGATTCCCATATTTCTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016561
VALIDATED
BFAR MISSION shRNA Bacterial Glycerol Stock
bifunctional apoptosis regulator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1166s21c1
Sequence:CCGGCCTACCTTTCATCCACACCATCTCGAGATGGTGTGGATGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1384s21c1
Sequence:CCGGTACTCTCAGTTCTGGAATTATCTCGAGATAATTCCAGAACTGAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-441s21c1
Sequence:CCGGTGCCGTCACTGCCTTGCTTTACTCGAGTAAAGCAAGGCAGTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-2106s21c1
Sequence:CCGGGGCATAGAGAGTTGCACATAACTCGAGTTATGTGCAACTCTCTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1328s21c1
Sequence:CCGGGGACTGGTTGGAGGTCCATTACTCGAGTAATGGACCTCCAACCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-1429s1c1
Sequence:CCGGGCCCTGTACTTTAACCCAATTCTCGAGAATTGGGTTAAAGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-915s1c1
Sequence:CCGGCCAGAATCTCTGGGAATATAACTCGAGTTATATTCCCAGAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-226s1c1
Sequence:CCGGCCTCAGATTTCTGTTAGTGAACTCGAGTTCACTAACAGAAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-445s1c1
Sequence:CCGGGCCATTAGACTGAGATTTGAACTCGAGTTCAAATCTCAGTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-1038s1c1
Sequence:CCGGCCTACCTTTCATCCACACCATCTCGAGATGGTGTGGATGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016561
VALIDATED
BFAR MISSION shRNA shRNA Plasmid DNA
bifunctional apoptosis regulator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1166s21c1
Sequence:CCGGCCTACCTTTCATCCACACCATCTCGAGATGGTGTGGATGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1384s21c1
Sequence:CCGGTACTCTCAGTTCTGGAATTATCTCGAGATAATTCCAGAACTGAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-441s21c1
Sequence:CCGGTGCCGTCACTGCCTTGCTTTACTCGAGTAAAGCAAGGCAGTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-2106s21c1
Sequence:CCGGGGCATAGAGAGTTGCACATAACTCGAGTTATGTGCAACTCTCTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1328s21c1
Sequence:CCGGGGACTGGTTGGAGGTCCATTACTCGAGTAATGGACCTCCAACCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-1429s1c1
Sequence:CCGGGCCCTGTACTTTAACCCAATTCTCGAGAATTGGGTTAAAGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-915s1c1
Sequence:CCGGCCAGAATCTCTGGGAATATAACTCGAGTTATATTCCCAGAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-226s1c1
Sequence:CCGGCCTCAGATTTCTGTTAGTGAACTCGAGTTCACTAACAGAAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-445s1c1
Sequence:CCGGGCCATTAGACTGAGATTTGAACTCGAGTTCAAATCTCAGTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-1038s1c1
Sequence:CCGGCCTACCTTTCATCCACACCATCTCGAGATGGTGTGGATGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016561
VALIDATED
BFAR MISSION shRNA Lentiviral Transduction Particles
bifunctional apoptosis regulator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1166s21c1
Sequence:CCGGCCTACCTTTCATCCACACCATCTCGAGATGGTGTGGATGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1384s21c1
Sequence:CCGGTACTCTCAGTTCTGGAATTATCTCGAGATAATTCCAGAACTGAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-441s21c1
Sequence:CCGGTGCCGTCACTGCCTTGCTTTACTCGAGTAAAGCAAGGCAGTGACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-2106s21c1
Sequence:CCGGGGCATAGAGAGTTGCACATAACTCGAGTTATGTGCAACTCTCTATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_016561.2-1328s21c1
Sequence:CCGGGGACTGGTTGGAGGTCCATTACTCGAGTAATGGACCTCCAACCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-1429s1c1
Sequence:CCGGGCCCTGTACTTTAACCCAATTCTCGAGAATTGGGTTAAAGTACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-915s1c1
Sequence:CCGGCCAGAATCTCTGGGAATATAACTCGAGTTATATTCCCAGAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-226s1c1
Sequence:CCGGCCTCAGATTTCTGTTAGTGAACTCGAGTTCACTAACAGAAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-445s1c1
Sequence:CCGGGCCATTAGACTGAGATTTGAACTCGAGTTCAAATCTCAGTCTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016561.1-1038s1c1
Sequence:CCGGCCTACCTTTCATCCACACCATCTCGAGATGGTGTGGATGAAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks