EMAIL THIS PAGE TO A FRIEND

BFSP1

beaded filament structural protein 1, filensin

Synonyms: CP115 CP94 CTRCT33 LIFL-H
UniProtKB ID: Q12934, O43595, O76034, O95676, Q8IVZ6, Q9HBX4
Gene ID:
Human(631) Summary: This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(12075) beaded filament structural protein 1, in lens-CP94
Rat(25394) beaded filament structural protein 1, filensin
naked mole-rat(101710644) beaded filament structural protein 1, filensin
domestic guinea pig(100170758) beaded filament structural protein 1, in lens-CP94
sheep(101121536) beaded filament structural protein 1, filensin
Domestic Rabbit(100347138) beaded filament structural protein 1, filensin
chicken(396056) beaded filament structural protein 1, filensin
dog(485756) beaded filament structural protein 1, filensin
domestic cat(101081132) beaded filament structural protein 1, filensin
cow(281644) beaded filament structural protein 1, filensin
Horse(100062535) beaded filament structural protein 1, filensin
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009751 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009751 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009751 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030451 MISSION® esiRNA esiRNA human BFSP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001195 Rosetta Predictions human pricing
NM_031555 Rosetta Predictions rat pricing
NM_009751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102057 predicted 766
2 SASI_Hs01_00102058 predicted 1880
3 SASI_Hs01_00102059 predicted 437
4 SASI_Hs02_00331333 predicted 1882
5 SASI_Hs01_00102060 predicted 386
6 SASI_Hs02_00331334 predicted 1421
7 SASI_Hs01_00102061 predicted 546
8 SASI_Hs01_00102063 predicted 1605
9 SASI_Hs01_00102064 predicted 906
10 SASI_Hs01_00102065 predicted 1903
11 SASI_Hs01_00102062 predicted 516
12 SASI_Hs01_00102066 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264747 predicted 1102
2 SASI_Rn02_00264748 predicted 1907
3 SASI_Rn02_00264749 predicted 566
4 SASI_Rn02_00264750 predicted 382
5 SASI_Rn02_00264751 predicted 1742
6 SASI_Rn02_00264752 predicted 383
7 SASI_Rn02_00264753 predicted 1592
8 SASI_Rn02_00264754 predicted 740
9 SASI_Rn02_00264755 predicted 1832
10 SASI_Rn02_00264756 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121139 predicted 702
2 SASI_Mm01_00121140 predicted 661
3 SASI_Mm01_00121141 predicted 1333
4 SASI_Mm01_00121142 predicted 1944
5 SASI_Mm01_00121143 predicted 1331
6 SASI_Mm01_00121144 predicted 2147
7 SASI_Mm01_00121145 predicted 2091
8 SASI_Mm01_00121146 predicted 1119
9 SASI_Mm01_00121147 predicted 2105
10 SASI_Mm01_00121148 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001195
BFSP1 MISSION shRNA Bacterial Glycerol Stock
beaded filament structural protein 1, filensin
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001195.2-2002s1c1
Sequence:CCGGGCCCAGGCTTGATGGGATAAACTCGAGTTTATCCCATCAAGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-967s1c1
Sequence:CCGGGCCTTCATTGAAACTCCCATTCTCGAGAATGGGAGTTTCAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-1059s1c1
Sequence:CCGGGCAGGATATAACAGCAGCAAACTCGAGTTTGCTGCTGTTATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-1873s1c1
Sequence:CCGGGTGGAATCTATCGAGAAGATTCTCGAGAATCTTCTCGATAGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-427s1c1
Sequence:CCGGCGGCTTAACAAGGAAGCTGATCTCGAGATCAGCTTCCTTGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001195.3-781s21c1
Sequence:CCGGACTCTGGAACAAGCTATTAAACTCGAGTTTAATAGCTTGTTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001195
BFSP1 MISSION shRNA shRNA Plasmid DNA
beaded filament structural protein 1, filensin
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001195.2-2002s1c1
Sequence:CCGGGCCCAGGCTTGATGGGATAAACTCGAGTTTATCCCATCAAGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-967s1c1
Sequence:CCGGGCCTTCATTGAAACTCCCATTCTCGAGAATGGGAGTTTCAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-1059s1c1
Sequence:CCGGGCAGGATATAACAGCAGCAAACTCGAGTTTGCTGCTGTTATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-1873s1c1
Sequence:CCGGGTGGAATCTATCGAGAAGATTCTCGAGAATCTTCTCGATAGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-427s1c1
Sequence:CCGGCGGCTTAACAAGGAAGCTGATCTCGAGATCAGCTTCCTTGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001195.3-781s21c1
Sequence:CCGGACTCTGGAACAAGCTATTAAACTCGAGTTTAATAGCTTGTTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001195
BFSP1 MISSION shRNA Lentiviral Transduction Particles
beaded filament structural protein 1, filensin
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001195.2-2002s1c1
Sequence:CCGGGCCCAGGCTTGATGGGATAAACTCGAGTTTATCCCATCAAGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-967s1c1
Sequence:CCGGGCCTTCATTGAAACTCCCATTCTCGAGAATGGGAGTTTCAATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-1059s1c1
Sequence:CCGGGCAGGATATAACAGCAGCAAACTCGAGTTTGCTGCTGTTATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-1873s1c1
Sequence:CCGGGTGGAATCTATCGAGAAGATTCTCGAGAATCTTCTCGATAGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001195.2-427s1c1
Sequence:CCGGCGGCTTAACAAGGAAGCTGATCTCGAGATCAGCTTCCTTGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001195.3-781s21c1
Sequence:CCGGACTCTGGAACAAGCTATTAAACTCGAGTTTAATAGCTTGTTCCAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009751
BFSP1 MISSION shRNA Bacterial Glycerol Stock
beaded filament structural protein 1, filensin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1277s1c1
Sequence:CCGGGCAGGATATTACAGCAGCTAACTCGAGTTAGCTGCTGTAATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1137s1c1
Sequence:CCGGGACCGTTATCATCGGATCATTCTCGAGAATGATCCGATGATAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-648s1c1
Sequence:CCGGCGGCTTAACAAGGAAGCCGATCTCGAGATCGGCTTCCTTGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1136s1c1
Sequence:CCGGAGACCGTTATCATCGGATCATCTCGAGATGATCCGATGATAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-959s21c1
Sequence:CCGGGGCCCTGGAACAAGCTATTAACTCGAGTTAATAGCTTGTTCCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-2098s21c1
Sequence:CCGGTGGAATCCATTGAGAAGATTTCTCGAGAAATCTTCTCAATGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-1815s21c1
Sequence:CCGGAGGGAAGGTGACCACTCAAACCTCGAGGTTTGAGTGGTCACCTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-2139s21c1
Sequence:CCGGTATGAAGAGACTTCCGTAATTCTCGAGAATTACGGAAGTCTCTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-581s21c1
Sequence:CCGGCGACGAGTTCCGCAGCAAATACTCGAGTATTTGCTGCGGAACTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009751
BFSP1 MISSION shRNA shRNA Plasmid DNA
beaded filament structural protein 1, filensin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1277s1c1
Sequence:CCGGGCAGGATATTACAGCAGCTAACTCGAGTTAGCTGCTGTAATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1137s1c1
Sequence:CCGGGACCGTTATCATCGGATCATTCTCGAGAATGATCCGATGATAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-648s1c1
Sequence:CCGGCGGCTTAACAAGGAAGCCGATCTCGAGATCGGCTTCCTTGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1136s1c1
Sequence:CCGGAGACCGTTATCATCGGATCATCTCGAGATGATCCGATGATAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-959s21c1
Sequence:CCGGGGCCCTGGAACAAGCTATTAACTCGAGTTAATAGCTTGTTCCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-2098s21c1
Sequence:CCGGTGGAATCCATTGAGAAGATTTCTCGAGAAATCTTCTCAATGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-1815s21c1
Sequence:CCGGAGGGAAGGTGACCACTCAAACCTCGAGGTTTGAGTGGTCACCTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-2139s21c1
Sequence:CCGGTATGAAGAGACTTCCGTAATTCTCGAGAATTACGGAAGTCTCTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-581s21c1
Sequence:CCGGCGACGAGTTCCGCAGCAAATACTCGAGTATTTGCTGCGGAACTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009751
BFSP1 MISSION shRNA Lentiviral Transduction Particles
beaded filament structural protein 1, filensin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1277s1c1
Sequence:CCGGGCAGGATATTACAGCAGCTAACTCGAGTTAGCTGCTGTAATATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1137s1c1
Sequence:CCGGGACCGTTATCATCGGATCATTCTCGAGAATGATCCGATGATAACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-648s1c1
Sequence:CCGGCGGCTTAACAAGGAAGCCGATCTCGAGATCGGCTTCCTTGTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009751.2-1136s1c1
Sequence:CCGGAGACCGTTATCATCGGATCATCTCGAGATGATCCGATGATAACGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-959s21c1
Sequence:CCGGGGCCCTGGAACAAGCTATTAACTCGAGTTAATAGCTTGTTCCAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-2098s21c1
Sequence:CCGGTGGAATCCATTGAGAAGATTTCTCGAGAAATCTTCTCAATGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-1815s21c1
Sequence:CCGGAGGGAAGGTGACCACTCAAACCTCGAGGTTTGAGTGGTCACCTTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-2139s21c1
Sequence:CCGGTATGAAGAGACTTCCGTAATTCTCGAGAATTACGGAAGTCTCTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009751.2-581s21c1
Sequence:CCGGCGACGAGTTCCGCAGCAAATACTCGAGTATTTGCTGCGGAACTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks