EMAIL THIS PAGE TO A FRIEND

BFSP2

beaded filament structural protein 2, phakinin

71 Gene Product Result for
Synonyms: CP47 CP49 CTRCT12 LIFL-L PHAKOSIN
UniProtKB ID: Q13515, Q14D32, Q9HBW5
Gene ID:
Human(8419) Summary: More than 99% of the vertebrate ocular lens is comprised of terminally differentiated lens fiber cells. Two lens-specific intermediate filament-like proteins, the protein product of this gene (phakinin), and filensin, are expressed only after fiber cell differentiation has begun. Both proteins are found in a structurally unique cytoskeletal element that is referred to as the beaded filament (BF). Mutations in this gene have been associated with juvenile-onset, progressive cataracts and Dowling-Meara epidermolysis bullosa simplex. [provided by RefSeq, Jun 2009]
Mouse(107993) beaded filament structural protein 2, phakinin
Rat(501046) beaded filament structural protein 2, phakinin
Zebrafish(494090) beaded filament structural protein 2, phakinin
cow(281645) beaded filament structural protein 2, phakinin
domestic cat(101087862) beaded filament structural protein 2, phakinin
dog(608938) beaded filament structural protein 2, phakinin
chicken(396141) beaded filament structural protein 2, phakinin
sheep(101115341) beaded filament structural protein 2, phakinin
Domestic Rabbit(100101576) beaded filament structural protein 2, phakinin
domestic guinea pig(100306969) beaded filament structural protein 2, phakinin
naked mole-rat(101716747) beaded filament structural protein 2, phakinin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003571 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001002896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129731 MISSION® esiRNA esiRNA human BFSP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003571 Rosetta Predictions human pricing
XM_001069678 Rosetta Predictions rat pricing
XR_006440 Rosetta Predictions rat pricing
NM_001002896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187131 predicted 841
2 SASI_Hs01_00187132 predicted 690
3 SASI_Hs02_00335880 predicted 1365
4 SASI_Hs01_00187133 predicted 647
5 SASI_Hs01_00187134 predicted 480
6 SASI_Hs01_00187135 predicted 758
7 SASI_Hs01_00187136 predicted 834
8 SASI_Hs01_00187137 predicted 770
9 SASI_Hs01_00187138 predicted 548
10 SASI_Hs01_00187140 predicted 1135
11 SASI_Hs01_00187139 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328862 predicted 421
2 SASI_Rn02_00328863 predicted 796
3 SASI_Rn02_00328864 predicted 675
4 SASI_Rn02_00328865 predicted 635
5 SASI_Rn02_00328866 predicted 963
6 SASI_Rn02_00328867 predicted 1065
7 SASI_Rn02_00328868 predicted 1253
8 SASI_Rn02_00328869 predicted 599
9 SASI_Rn02_00328870 predicted 1236
10 SASI_Rn02_00328871 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131136 predicted 1299
2 SASI_Rn01_00131137 predicted 1285
3 SASI_Rn01_00131138 predicted 1282
4 SASI_Rn01_00131139 predicted 1157
5 SASI_Rn01_00131142 predicted 1160
6 SASI_Rn01_00131143 predicted 1271
7 SASI_Rn01_00131144 predicted 1159
8 SASI_Rn02_00412027 predicted 1178
9 SASI_Rn02_00412028 predicted 1290
10 SASI_Rn02_00412029 predicted 1160
11 SASI_Rn01_00131140 predicted 1348
12 SASI_Rn01_00131141 predicted 1179
13 SASI_Rn01_00131145 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106847 predicted 992
2 SASI_Mm01_00106848 predicted 710
3 SASI_Mm01_00106849 predicted 826
4 SASI_Mm01_00106850 predicted 1286
5 SASI_Mm01_00106851 predicted 974
6 SASI_Mm01_00106852 predicted 763
7 SASI_Mm01_00106853 predicted 641
8 SASI_Mm01_00106855 predicted 1275
9 SASI_Mm01_00106856 predicted 531
10 SASI_Mm02_00286310 predicted 1335
11 SASI_Mm01_00106854 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003571
BFSP2 MISSION shRNA Bacterial Glycerol Stock
beaded filament structural protein 2, phakinin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-771s21c1
Sequence:CCGGAGTCATTGATGAGGCTAATTTCTCGAGAAATTAGCCTCATCAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-835s21c1
Sequence:CCGGGAACTTGGCTCTCTATCAAGACTCGAGTCTTGATAGAGAGCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-483s21c1
Sequence:CCGGGGTGGAATATATGGCCAAAGTCTCGAGACTTTGGCCATATATTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-1088s21c1
Sequence:CCGGTCAGGGTGGAGTTACACAACACTCGAGTGTTGTGTAACTCCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003571.2-1445s21c1
Sequence:CCGGAGTTGCTTGAGGAGCTTTCTCCTCGAGGAGAAAGCTCCTCAAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003571.2-1479s1c1
Sequence:CCGGCCTGCTGGATTCCCTGGTTAACTCGAGTTAACCAGGGAATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-948s1c1
Sequence:CCGGCATCCTTGAGACGATCAGAATCTCGAGATTCTGATCGTCTCAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-970s1c1
Sequence:CCGGCAGTGGGAGAGAGATGTTGAACTCGAGTTCAACATCTCTCTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-810s1c1
Sequence:CCGGGAGTCAAATAGAAAGTCTGAACTCGAGTTCAGACTTTCTATTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-685s1c1
Sequence:CCGGGCCGGAGCAGATGACTTTAAACTCGAGTTTAAAGTCATCTGCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003571
BFSP2 MISSION shRNA shRNA Plasmid DNA
beaded filament structural protein 2, phakinin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-771s21c1
Sequence:CCGGAGTCATTGATGAGGCTAATTTCTCGAGAAATTAGCCTCATCAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-835s21c1
Sequence:CCGGGAACTTGGCTCTCTATCAAGACTCGAGTCTTGATAGAGAGCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-483s21c1
Sequence:CCGGGGTGGAATATATGGCCAAAGTCTCGAGACTTTGGCCATATATTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-1088s21c1
Sequence:CCGGTCAGGGTGGAGTTACACAACACTCGAGTGTTGTGTAACTCCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003571.2-1445s21c1
Sequence:CCGGAGTTGCTTGAGGAGCTTTCTCCTCGAGGAGAAAGCTCCTCAAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003571.2-1479s1c1
Sequence:CCGGCCTGCTGGATTCCCTGGTTAACTCGAGTTAACCAGGGAATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-948s1c1
Sequence:CCGGCATCCTTGAGACGATCAGAATCTCGAGATTCTGATCGTCTCAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-970s1c1
Sequence:CCGGCAGTGGGAGAGAGATGTTGAACTCGAGTTCAACATCTCTCTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-810s1c1
Sequence:CCGGGAGTCAAATAGAAAGTCTGAACTCGAGTTCAGACTTTCTATTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-685s1c1
Sequence:CCGGGCCGGAGCAGATGACTTTAAACTCGAGTTTAAAGTCATCTGCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003571
BFSP2 MISSION shRNA Lentiviral Transduction Particles
beaded filament structural protein 2, phakinin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-771s21c1
Sequence:CCGGAGTCATTGATGAGGCTAATTTCTCGAGAAATTAGCCTCATCAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-835s21c1
Sequence:CCGGGAACTTGGCTCTCTATCAAGACTCGAGTCTTGATAGAGAGCCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-483s21c1
Sequence:CCGGGGTGGAATATATGGCCAAAGTCTCGAGACTTTGGCCATATATTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003571.2-1088s21c1
Sequence:CCGGTCAGGGTGGAGTTACACAACACTCGAGTGTTGTGTAACTCCACCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003571.2-1445s21c1
Sequence:CCGGAGTTGCTTGAGGAGCTTTCTCCTCGAGGAGAAAGCTCCTCAAGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003571.2-1479s1c1
Sequence:CCGGCCTGCTGGATTCCCTGGTTAACTCGAGTTAACCAGGGAATCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-948s1c1
Sequence:CCGGCATCCTTGAGACGATCAGAATCTCGAGATTCTGATCGTCTCAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-970s1c1
Sequence:CCGGCAGTGGGAGAGAGATGTTGAACTCGAGTTCAACATCTCTCTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-810s1c1
Sequence:CCGGGAGTCAAATAGAAAGTCTGAACTCGAGTTCAGACTTTCTATTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003571.2-685s1c1
Sequence:CCGGGCCGGAGCAGATGACTTTAAACTCGAGTTTAAAGTCATCTGCTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002896
BFSP2 MISSION shRNA Bacterial Glycerol Stock
beaded filament structural protein 2, phakinin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002896.1-1414s1c1
Sequence:CCGGCCACCGGTGACGTCTGAAGAACTCGAGTTCTTCAGACGTCACCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-1058s1c1
Sequence:CCGGGTGTAGAGTTACACGACACTTCTCGAGAAGTGTCGTGTAACTCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-659s1c1
Sequence:CCGGCGGATGACTTTAAAGAGAGATCTCGAGATCTCTCTTTAAAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-1098s1c1
Sequence:CCGGCCAGGCTGAGACGGAATCTTTCTCGAGAAAGATTCCGTCTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-744s1c1
Sequence:CCGGCGATGAAGCTAATTTGACAAACTCGAGTTTGTCAAATTAGCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002896
BFSP2 MISSION shRNA shRNA Plasmid DNA
beaded filament structural protein 2, phakinin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002896.1-1414s1c1
Sequence:CCGGCCACCGGTGACGTCTGAAGAACTCGAGTTCTTCAGACGTCACCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-1058s1c1
Sequence:CCGGGTGTAGAGTTACACGACACTTCTCGAGAAGTGTCGTGTAACTCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-659s1c1
Sequence:CCGGCGGATGACTTTAAAGAGAGATCTCGAGATCTCTCTTTAAAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-1098s1c1
Sequence:CCGGCCAGGCTGAGACGGAATCTTTCTCGAGAAAGATTCCGTCTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-744s1c1
Sequence:CCGGCGATGAAGCTAATTTGACAAACTCGAGTTTGTCAAATTAGCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002896
BFSP2 MISSION shRNA Lentiviral Transduction Particles
beaded filament structural protein 2, phakinin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002896.1-1414s1c1
Sequence:CCGGCCACCGGTGACGTCTGAAGAACTCGAGTTCTTCAGACGTCACCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-1058s1c1
Sequence:CCGGGTGTAGAGTTACACGACACTTCTCGAGAAGTGTCGTGTAACTCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-659s1c1
Sequence:CCGGCGGATGACTTTAAAGAGAGATCTCGAGATCTCTCTTTAAAGTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-1098s1c1
Sequence:CCGGCCAGGCTGAGACGGAATCTTTCTCGAGAAAGATTCCGTCTCAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002896.1-744s1c1
Sequence:CCGGCGATGAAGCTAATTTGACAAACTCGAGTTTGTCAAATTAGCTTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks