EMAIL THIS PAGE TO A FRIEND

BGLAP

bone gamma-carboxyglutamate (gla) protein

69 Gene Product Result for
Synonyms: BGP OC OCN
UniProtKB ID: P02818, Q5TCK6
Gene ID:
Mouse(12096) bone gamma carboxyglutamate protein
Rat(25295) bone gamma-carboxyglutamate (gla) protein
Zebrafish(494531) bone gamma-carboxyglutamate (gla) protein
cow(281646) bone gamma-carboxyglutamate (gla) protein
chicken(396348) bone gamma-carboxyglutamate (gla) protein
domestic cat(101085947) bone gamma-carboxyglutamate (gla) protein
dog(403762) bone gamma-carboxyglutamate (gla) protein
domestic guinea pig(100735766) bone gamma-carboxyglutamate (gla) protein
sheep(677670) bone gamma-carboxyglutamate (gla) protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199173 Rosetta Predictions human pricing
NM_013414 Rosetta Predictions rat pricing
NM_001037939 Rosetta Predictions mouse pricing
NM_007541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372608 predicted 213
2 SASI_Hs01_00225675 predicted 278
3 SASI_Hs01_00225676 predicted 284
4 SASI_Hs01_00225677 predicted 286
5 SASI_Hs01_00225678 predicted 281
6 SASI_Hs02_00372609 predicted 206
7 SASI_Hs02_00372610 predicted 214
8 SASI_Hs01_00225679 predicted 307
9 SASI_Hs02_00372611 predicted 216
10 SASI_Hs02_00372612 predicted 208
11 SASI_Hs01_00225680 predicted 262
12 SASI_Hs01_00225681 predicted 237
13 SASI_Hs01_00225682 predicted 253
14 SASI_Hs01_00225683 predicted 233
15 SASI_Hs01_00225684 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085607 predicted 238
2 SASI_Rn01_00085608 predicted 247
3 SASI_Rn01_00085609 predicted 240
4 SASI_Rn01_00085610 predicted 247
5 SASI_Rn01_00085611 predicted 251
6 SASI_Rn01_00085612 predicted 126
7 SASI_Rn01_00085613 predicted 279
8 SASI_Rn01_00085614 predicted 339
9 SASI_Rn02_00261119 predicted 124
10 SASI_Rn01_00085615 predicted 317
11 SASI_Rn01_00085616 predicted 170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146504 predicted 225
2 SASI_Mm01_00146505 predicted 48
3 SASI_Mm01_00146506 predicted 215
4 SASI_Mm01_00146507 predicted 237
5 SASI_Mm01_00146508 predicted 51
6 SASI_Mm01_00146509 predicted 235
7 SASI_Mm01_00146510 predicted 218
8 SASI_Mm01_00146511 predicted 276
9 SASI_Mm01_00146512 predicted 215
10 SASI_Mm01_00146513 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054228 predicted 234
2 SASI_Mm01_00054229 predicted 236
3 SASI_Mm01_00054230 predicted 235
4 SASI_Mm01_00054231 predicted 230
5 SASI_Mm01_00054232 predicted 48
6 SASI_Mm01_00054233 predicted 54
7 SASI_Mm01_00054234 predicted 388
8 SASI_Mm01_00054235 predicted 370
9 SASI_Mm01_00054236 predicted 298
10 SASI_Mm01_00054237 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007541
BGLAP MISSION shRNA Bacterial Glycerol Stock
bone gamma-carboxyglutamate (gla) protein
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-210s1c1
Sequence:CCGGCCGGGAGCAGTGTGAGCTTAACTCGAGTTAAGCTCACACTGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-283s1c1
Sequence:CCGGCGCATCTATGGTATCACTATTCTCGAGAATAGTGATACCATAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-214s1c1
Sequence:CCGGGAGCAGTGTGAGCTTAACCCTCTCGAGAGGGTTAAGCTCACACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-102s1c1
Sequence:CCGGTGAGTCTGACAAAGCCTTCATCTCGAGATGAAGGCTTTGTCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-271s1c1
Sequence:CCGGACCGCCTACAAACGCATCTATCTCGAGATAGATGCGTTTGTAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-274s21c1
Sequence:CCGGCGAGCTATCAGACCAGTATGGCTCGAGCCATACTGGTCTGATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-163s21c1
Sequence:CCGGGGAGGGCAATAAGGTAGTGAACTCGAGTTCACTACCTTATTGCCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-293s21c1
Sequence:CCGGGGCTTGAAGACCGCCTACAAACTCGAGTTTGTAGGCGGTCTTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-316s21c1
Sequence:CCGGCATCTATGGTATCACTATTTACTCGAGTAAATAGTGATACCATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-263s21c1
Sequence:CCGGCCTGCTTGTGACGAGCTATCACTCGAGTGATAGCTCGTCACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-153s21c1
Sequence:CCGGTGTCCAAGCAGGAGGGCAATACTCGAGTATTGCCCTCCTGCTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-93s21c1
Sequence:CCGGTCTGTCTCTCTGACCTCACAGCTCGAGCTGTGAGGTCAGAGAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007541
BGLAP MISSION shRNA shRNA Plasmid DNA
bone gamma-carboxyglutamate (gla) protein
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-210s1c1
Sequence:CCGGCCGGGAGCAGTGTGAGCTTAACTCGAGTTAAGCTCACACTGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-283s1c1
Sequence:CCGGCGCATCTATGGTATCACTATTCTCGAGAATAGTGATACCATAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-214s1c1
Sequence:CCGGGAGCAGTGTGAGCTTAACCCTCTCGAGAGGGTTAAGCTCACACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-102s1c1
Sequence:CCGGTGAGTCTGACAAAGCCTTCATCTCGAGATGAAGGCTTTGTCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-271s1c1
Sequence:CCGGACCGCCTACAAACGCATCTATCTCGAGATAGATGCGTTTGTAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-274s21c1
Sequence:CCGGCGAGCTATCAGACCAGTATGGCTCGAGCCATACTGGTCTGATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-163s21c1
Sequence:CCGGGGAGGGCAATAAGGTAGTGAACTCGAGTTCACTACCTTATTGCCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-293s21c1
Sequence:CCGGGGCTTGAAGACCGCCTACAAACTCGAGTTTGTAGGCGGTCTTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-316s21c1
Sequence:CCGGCATCTATGGTATCACTATTTACTCGAGTAAATAGTGATACCATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-263s21c1
Sequence:CCGGCCTGCTTGTGACGAGCTATCACTCGAGTGATAGCTCGTCACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-153s21c1
Sequence:CCGGTGTCCAAGCAGGAGGGCAATACTCGAGTATTGCCCTCCTGCTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-93s21c1
Sequence:CCGGTCTGTCTCTCTGACCTCACAGCTCGAGCTGTGAGGTCAGAGAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007541
BGLAP MISSION shRNA Lentiviral Transduction Particles
bone gamma-carboxyglutamate (gla) protein
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-210s1c1
Sequence:CCGGCCGGGAGCAGTGTGAGCTTAACTCGAGTTAAGCTCACACTGCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-283s1c1
Sequence:CCGGCGCATCTATGGTATCACTATTCTCGAGAATAGTGATACCATAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-214s1c1
Sequence:CCGGGAGCAGTGTGAGCTTAACCCTCTCGAGAGGGTTAAGCTCACACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-102s1c1
Sequence:CCGGTGAGTCTGACAAAGCCTTCATCTCGAGATGAAGGCTTTGTCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007541.1-271s1c1
Sequence:CCGGACCGCCTACAAACGCATCTATCTCGAGATAGATGCGTTTGTAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-274s21c1
Sequence:CCGGCGAGCTATCAGACCAGTATGGCTCGAGCCATACTGGTCTGATAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-163s21c1
Sequence:CCGGGGAGGGCAATAAGGTAGTGAACTCGAGTTCACTACCTTATTGCCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-293s21c1
Sequence:CCGGGGCTTGAAGACCGCCTACAAACTCGAGTTTGTAGGCGGTCTTCAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-316s21c1
Sequence:CCGGCATCTATGGTATCACTATTTACTCGAGTAAATAGTGATACCATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-263s21c1
Sequence:CCGGCCTGCTTGTGACGAGCTATCACTCGAGTGATAGCTCGTCACAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-153s21c1
Sequence:CCGGTGTCCAAGCAGGAGGGCAATACTCGAGTATTGCCCTCCTGCTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007541.2-93s21c1
Sequence:CCGGTCTGTCTCTCTGACCTCACAGCTCGAGCTGTGAGGTCAGAGAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000711
BGLAP MISSION shRNA Bacterial Glycerol Stock
bone gamma-carboxyglutamate (gla) protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-146s1c1
Sequence:CCGGGCGAGGTAGTGAAGAGACCCACTCGAGTGGGTCTCTTCACTACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-258s1c1
Sequence:CCGGTGACGAGTTGGCTGACCACATCTCGAGATGTGGTCAGCCAACTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-276s1c1
Sequence:CCGGCATCGGCTTTCAGGAGGCCTACTCGAGTAGGCCTCCTGAAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-94s1c1
Sequence:CCGGAGCGGTGCAGAGTCCAGCAAACTCGAGTTTGCTGGACTCTGCACCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-163s1c1
Sequence:CCGGCCCAGGCGCTACCTGTATCAACTCGAGTTGATACAGGTAGCGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000711
BGLAP MISSION shRNA shRNA Plasmid DNA
bone gamma-carboxyglutamate (gla) protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-146s1c1
Sequence:CCGGGCGAGGTAGTGAAGAGACCCACTCGAGTGGGTCTCTTCACTACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-258s1c1
Sequence:CCGGTGACGAGTTGGCTGACCACATCTCGAGATGTGGTCAGCCAACTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-276s1c1
Sequence:CCGGCATCGGCTTTCAGGAGGCCTACTCGAGTAGGCCTCCTGAAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-94s1c1
Sequence:CCGGAGCGGTGCAGAGTCCAGCAAACTCGAGTTTGCTGGACTCTGCACCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-163s1c1
Sequence:CCGGCCCAGGCGCTACCTGTATCAACTCGAGTTGATACAGGTAGCGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000711
BGLAP MISSION shRNA Lentiviral Transduction Particles
bone gamma-carboxyglutamate (gla) protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-146s1c1
Sequence:CCGGGCGAGGTAGTGAAGAGACCCACTCGAGTGGGTCTCTTCACTACCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-258s1c1
Sequence:CCGGTGACGAGTTGGCTGACCACATCTCGAGATGTGGTCAGCCAACTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-276s1c1
Sequence:CCGGCATCGGCTTTCAGGAGGCCTACTCGAGTAGGCCTCCTGAAAGCCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-94s1c1
Sequence:CCGGAGCGGTGCAGAGTCCAGCAAACTCGAGTTTGCTGGACTCTGCACCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000711.1-163s1c1
Sequence:CCGGCCCAGGCGCTACCTGTATCAACTCGAGTTGATACAGGTAGCGCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199173
BGLAP MISSION shRNA Bacterial Glycerol Stock
bone gamma-carboxyglutamate (gla) protein
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000377662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-98s21c1
Sequence:CCGGTATTGGCCCTGGCCGCACTTTCTCGAGAAAGTGCGGCCAGGGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-300s21c1
Sequence:CCGGCAATCCGGACTGTGACGAGTTCTCGAGAACTCGTCACAGTCCGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-174s21c1
Sequence:CCGGAGCCTTTGTGTCCAAGCAGGACTCGAGTCCTGCTTGGACACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199173
BGLAP MISSION shRNA shRNA Plasmid DNA
bone gamma-carboxyglutamate (gla) protein
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000377662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-98s21c1
Sequence:CCGGTATTGGCCCTGGCCGCACTTTCTCGAGAAAGTGCGGCCAGGGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-300s21c1
Sequence:CCGGCAATCCGGACTGTGACGAGTTCTCGAGAACTCGTCACAGTCCGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-174s21c1
Sequence:CCGGAGCCTTTGTGTCCAAGCAGGACTCGAGTCCTGCTTGGACACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199173
BGLAP MISSION shRNA Lentiviral Transduction Particles
bone gamma-carboxyglutamate (gla) protein
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000377662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-98s21c1
Sequence:CCGGTATTGGCCCTGGCCGCACTTTCTCGAGAAAGTGCGGCCAGGGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-300s21c1
Sequence:CCGGCAATCCGGACTGTGACGAGTTCTCGAGAACTCGTCACAGTCCGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199173.3-174s21c1
Sequence:CCGGAGCCTTTGTGTCCAAGCAGGACTCGAGTCCTGCTTGGACACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks