EMAIL THIS PAGE TO A FRIEND

BGN

biglycan

59 Gene Product Result for
Synonyms: DSPG1 PG-S1 PGI SLRR1A
UniProtKB ID: P21810, D3DWU3, P13247
Gene ID:
Human(633) Summary: The protein encoded by this gene is a small cellular or pericellular matrix proteoglycan that is closely related in structure to two other small proteoglycans, decorin and fibromodulin. The encoded protein and decorin are thought to be the result of a gene duplication. Decorin contains one attached glycosaminoglycan chain, while this protein probably contains two chains. For this reason, this protein is called biglycan. This protein plays a role in assembly of collagen fibrils and muscle regeneration. It interacts with several proteins involved in muscular dystrophy, including alpha-dystroglycan, alpha- and gamma-sarcoglycan and collagen VI, and it is critical for the assembly of the dystrophin-associated protein complex. [provided by RefSeq, Nov 2009]
Mouse(12111) biglycan
Rat(25181) biglycan
Horse(100033861) biglycan
Horse(100033879) biglycan
cow(280733) biglycan
dog(403905) biglycan
sheep(443011) biglycan
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001711 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001711 Rosetta Predictions human pricing
NM_017087 Rosetta Predictions rat pricing
NM_007542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131041 predicted 257
2 SASI_Hs02_00332401 predicted 1585
3 SASI_Hs01_00131042 predicted 568
4 SASI_Hs01_00131046 predicted 911
5 SASI_Hs01_00131048 predicted 333
6 SASI_Hs02_00332402 predicted 766
7 SASI_Hs01_00131049 predicted 287
8 SASI_Hs01_00131050 predicted 223
9 SASI_Hs02_00332403 predicted 852
10 SASI_Hs02_00332404 predicted 1600
11 SASI_Hs01_00131043 predicted 873
12 SASI_Hs01_00131044 predicted 759
13 SASI_Hs01_00131045 predicted 966
14 SASI_Hs01_00131047 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094937 predicted 865
2 SASI_Rn01_00094938 predicted 713
3 SASI_Rn01_00094939 predicted 519
4 SASI_Rn01_00094940 predicted 1097
5 SASI_Rn02_00261301 predicted 543
6 SASI_Rn01_00094941 predicted 613
7 SASI_Rn01_00094942 predicted 960
8 SASI_Rn01_00094943 predicted 379
9 SASI_Rn01_00094944 predicted 335
10 SASI_Rn01_00094945 predicted 844
11 SASI_Rn01_00094946 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037942 predicted 402
2 SASI_Mm01_00037943 predicted 1113
3 SASI_Mm01_00037944 predicted 535
4 SASI_Mm01_00037945 predicted 927
5 SASI_Mm01_00037946 predicted 886
6 SASI_Mm01_00037947 predicted 628
7 SASI_Mm01_00037948 predicted 666
8 SASI_Mm01_00037949 predicted 1097
9 SASI_Mm01_00037950 predicted 353
10 SASI_Mm01_00037951 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001711
BGN MISSION shRNA Bacterial Glycerol Stock
biglycan
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001711.3-1831s1c1
Sequence:CCGGCCTCCCTTCTGTTCTCTCTTTCTCGAGAAAGAGAGAACAGAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-595s1c1
Sequence:CCGGGAAGCTCTACATCTCCAAGAACTCGAGTTCTTGGAGATGTAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-721s1c1
Sequence:CCGGGAACATGAACTGCATCGAGATCTCGAGATCTCGATGCAGTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-268s1c1
Sequence:CCGGGCCATTCATGATGAACGATGACTCGAGTCATCGTTCATCATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-961s1c1
Sequence:CCGGCCAGATCAGGATGATCGAGAACTCGAGTTCTCGATCATCCTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-598s1c1
Sequence:CCGGGCTCTACATCTCCAAGAACCACTCGAGTGGTTCTTGGAGATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-1251s1c1
Sequence:CCGGCCATCCAGTTTGGCAACTACACTCGAGTGTAGTTGCCAAACTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-553s1c1
Sequence:CCGGCAAGATCCATGAGAAGGCCTTCTCGAGAAGGCCTTCTCATGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-526s21c1
Sequence:CCGGCCTCGTCCTGGTGAACAACAACTCGAGTTGTTGTTCACCAGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-921s21c1
Sequence:CCGGTTCGCTACTCCAAGCTGTACACTCGAGTGTACAGCTTGGAGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-786s21c1
Sequence:CCGGTCGATGGCCTGAAGCTCAACTCTCGAGAGTTGAGCTTCAGGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-863s21c1
Sequence:CCGGCTGAATGAACTCCACCTAGACCTCGAGGTCTAGGTGGAGTTCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001711
BGN MISSION shRNA shRNA Plasmid DNA
biglycan
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001711.3-1831s1c1
Sequence:CCGGCCTCCCTTCTGTTCTCTCTTTCTCGAGAAAGAGAGAACAGAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-595s1c1
Sequence:CCGGGAAGCTCTACATCTCCAAGAACTCGAGTTCTTGGAGATGTAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-721s1c1
Sequence:CCGGGAACATGAACTGCATCGAGATCTCGAGATCTCGATGCAGTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-268s1c1
Sequence:CCGGGCCATTCATGATGAACGATGACTCGAGTCATCGTTCATCATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-961s1c1
Sequence:CCGGCCAGATCAGGATGATCGAGAACTCGAGTTCTCGATCATCCTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-598s1c1
Sequence:CCGGGCTCTACATCTCCAAGAACCACTCGAGTGGTTCTTGGAGATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-1251s1c1
Sequence:CCGGCCATCCAGTTTGGCAACTACACTCGAGTGTAGTTGCCAAACTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-553s1c1
Sequence:CCGGCAAGATCCATGAGAAGGCCTTCTCGAGAAGGCCTTCTCATGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-526s21c1
Sequence:CCGGCCTCGTCCTGGTGAACAACAACTCGAGTTGTTGTTCACCAGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-921s21c1
Sequence:CCGGTTCGCTACTCCAAGCTGTACACTCGAGTGTACAGCTTGGAGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-786s21c1
Sequence:CCGGTCGATGGCCTGAAGCTCAACTCTCGAGAGTTGAGCTTCAGGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-863s21c1
Sequence:CCGGCTGAATGAACTCCACCTAGACCTCGAGGTCTAGGTGGAGTTCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001711
BGN MISSION shRNA Lentiviral Transduction Particles
biglycan
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001711.3-1831s1c1
Sequence:CCGGCCTCCCTTCTGTTCTCTCTTTCTCGAGAAAGAGAGAACAGAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-595s1c1
Sequence:CCGGGAAGCTCTACATCTCCAAGAACTCGAGTTCTTGGAGATGTAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-721s1c1
Sequence:CCGGGAACATGAACTGCATCGAGATCTCGAGATCTCGATGCAGTTCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-268s1c1
Sequence:CCGGGCCATTCATGATGAACGATGACTCGAGTCATCGTTCATCATGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-961s1c1
Sequence:CCGGCCAGATCAGGATGATCGAGAACTCGAGTTCTCGATCATCCTGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-598s1c1
Sequence:CCGGGCTCTACATCTCCAAGAACCACTCGAGTGGTTCTTGGAGATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001711.3-1251s1c1
Sequence:CCGGCCATCCAGTTTGGCAACTACACTCGAGTGTAGTTGCCAAACTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001711.3-553s1c1
Sequence:CCGGCAAGATCCATGAGAAGGCCTTCTCGAGAAGGCCTTCTCATGGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-526s21c1
Sequence:CCGGCCTCGTCCTGGTGAACAACAACTCGAGTTGTTGTTCACCAGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-921s21c1
Sequence:CCGGTTCGCTACTCCAAGCTGTACACTCGAGTGTACAGCTTGGAGTAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-786s21c1
Sequence:CCGGTCGATGGCCTGAAGCTCAACTCTCGAGAGTTGAGCTTCAGGCCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001711.3-863s21c1
Sequence:CCGGCTGAATGAACTCCACCTAGACCTCGAGGTCTAGGTGGAGTTCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007542
VALIDATED
BGN MISSION shRNA Bacterial Glycerol Stock
biglycan
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-1456s1c1
Sequence:CCGGCCACTCAGAGACTCCCTATAACTCGAGTTATAGGGAGTCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-872s1c1
Sequence:CCGGGCTATTGAGTTGGAGGACCTACTCGAGTAGGTCCTCCAACTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-622s1c1
Sequence:CCGGCTCCCTGGTAGAACTACGAATCTCGAGATTCGTAGTTCTACCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-497s1c1
Sequence:CCGGGCCCTGGTCTTGGTAAACAATCTCGAGATTGTTTACCAAGACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-1223s1c1
Sequence:CCGGGCCATCCAATTTGGAAATTATCTCGAGATAATTTCCAAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-619s21c1
Sequence:CCGGCTCCCTGGTAGAACTACGAATCTCGAGATTCGTAGTTCTACCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007542.4-1453s21c1
Sequence:CCGGCCACTCAGAGACTCCCTATAACTCGAGTTATAGGGAGTCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-1220s21c1
Sequence:CCGGGCCATCCAATTTGGAAATTATCTCGAGATAATTTCCAAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-494s21c1
Sequence:CCGGGCCCTGGTCTTGGTAAACAATCTCGAGATTGTTTACCAAGACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007542
VALIDATED
BGN MISSION shRNA shRNA Plasmid DNA
biglycan
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-1456s1c1
Sequence:CCGGCCACTCAGAGACTCCCTATAACTCGAGTTATAGGGAGTCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-872s1c1
Sequence:CCGGGCTATTGAGTTGGAGGACCTACTCGAGTAGGTCCTCCAACTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-622s1c1
Sequence:CCGGCTCCCTGGTAGAACTACGAATCTCGAGATTCGTAGTTCTACCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-497s1c1
Sequence:CCGGGCCCTGGTCTTGGTAAACAATCTCGAGATTGTTTACCAAGACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-1223s1c1
Sequence:CCGGGCCATCCAATTTGGAAATTATCTCGAGATAATTTCCAAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-619s21c1
Sequence:CCGGCTCCCTGGTAGAACTACGAATCTCGAGATTCGTAGTTCTACCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007542.4-1453s21c1
Sequence:CCGGCCACTCAGAGACTCCCTATAACTCGAGTTATAGGGAGTCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-1220s21c1
Sequence:CCGGGCCATCCAATTTGGAAATTATCTCGAGATAATTTCCAAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-494s21c1
Sequence:CCGGGCCCTGGTCTTGGTAAACAATCTCGAGATTGTTTACCAAGACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007542
VALIDATED
BGN MISSION shRNA Lentiviral Transduction Particles
biglycan
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-1456s1c1
Sequence:CCGGCCACTCAGAGACTCCCTATAACTCGAGTTATAGGGAGTCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-872s1c1
Sequence:CCGGGCTATTGAGTTGGAGGACCTACTCGAGTAGGTCCTCCAACTCAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-622s1c1
Sequence:CCGGCTCCCTGGTAGAACTACGAATCTCGAGATTCGTAGTTCTACCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-497s1c1
Sequence:CCGGGCCCTGGTCTTGGTAAACAATCTCGAGATTGTTTACCAAGACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007542.3-1223s1c1
Sequence:CCGGGCCATCCAATTTGGAAATTATCTCGAGATAATTTCCAAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-619s21c1
Sequence:CCGGCTCCCTGGTAGAACTACGAATCTCGAGATTCGTAGTTCTACCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007542.4-1453s21c1
Sequence:CCGGCCACTCAGAGACTCCCTATAACTCGAGTTATAGGGAGTCTCTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-1220s21c1
Sequence:CCGGGCCATCCAATTTGGAAATTATCTCGAGATAATTTCCAAATTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007542.4-494s21c1
Sequence:CCGGGCCCTGGTCTTGGTAAACAATCTCGAGATTGTTTACCAAGACCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks