EMAIL THIS PAGE TO A FRIEND

BHLHA15

basic helix-loop-helix family, member a15

59 Gene Product Result for
Synonyms: BHLHB8 MIST1
UniProtKB ID: Q7RTS1, A4D271, Q14DE4
Gene ID:
Mouse(17341) basic helix-loop-helix family, member a15
Rat(25334) basic helix-loop-helix family, member a15
Zebrafish(777671) basic helix-loop-helix family, member a15
domestic cat(101081593) basic helix-loop-helix family, member a15
cow(100848337) basic helix-loop-helix family, member a15
dog(489869) basic helix-loop-helix family, member a15
chicken(427655) basic helix-loop-helix family, member a15
naked mole-rat(101716441) basic helix-loop-helix family, member a15
domestic guinea pig(100725119) basic helix-loop-helix family, member a15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177455 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024791 MISSION® esiRNA esiRNA targeting mouse Bhlha15 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177455 Rosetta Predictions human pricing
NM_012863 Rosetta Predictions rat pricing
XM_579353 Rosetta Predictions rat pricing
NM_010800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042162 predicted 243
2 SASI_Hs01_00042163 predicted 331
3 SASI_Hs01_00042164 predicted 333
4 SASI_Hs01_00042165 predicted 310
5 SASI_Hs01_00042166 predicted 311
6 SASI_Hs01_00042167 predicted 309
7 SASI_Hs01_00042168 predicted 304
8 SASI_Hs01_00042169 predicted 302
9 SASI_Hs02_00369349 predicted 413
10 SASI_Hs01_00042171 predicted 393
11 SASI_Hs01_00042170 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097281 predicted 1059
2 SASI_Rn01_00097282 predicted 1050
3 SASI_Rn01_00097283 predicted 361
4 SASI_Rn01_00097284 predicted 364
5 SASI_Rn01_00097285 predicted 1103
6 SASI_Rn01_00097287 predicted 1199
7 SASI_Rn02_00260348 predicted 1017
8 SASI_Rn01_00097288 predicted 1131
9 SASI_Rn01_00097289 predicted 965
10 SASI_Rn01_00097290 predicted 1117
11 SASI_Rn01_00097286 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178123 predicted 373
2 SASI_Rn01_00178124 predicted 375
3 SASI_Rn01_00178125 predicted 377
4 SASI_Rn01_00178126 predicted 263
5 SASI_Rn01_00178127 predicted 362
6 SASI_Rn01_00178128 predicted 351
7 SASI_Rn01_00178129 predicted 359
8 SASI_Rn01_00178130 predicted 345
9 SASI_Rn01_00178131 predicted 363
10 SASI_Rn01_00178132 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319375 predicted 1195
2 SASI_Mm01_00200086 predicted 1125
3 SASI_Mm01_00200087 predicted 1017
4 SASI_Mm01_00200088 predicted 1117
5 SASI_Mm01_00200089 predicted 972
6 SASI_Mm01_00200090 predicted 1113
7 SASI_Mm02_00319376 predicted 1198
8 SASI_Mm02_00319377 predicted 1064
9 SASI_Mm02_00319378 predicted 361
10 SASI_Mm01_00200094 predicted 1025
11 SASI_Mm01_00200085 predicted 1197
12 SASI_Mm01_00200091 predicted 1135
13 SASI_Mm01_00200092 predicted 1059
14 SASI_Mm01_00200093 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177455
BHLHA15 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member a15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-276s1c1
Sequence:CCGGGCGGATGCACAAGCTAAATAACTCGAGTTATTTAGCTTGTGCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-378s1c1
Sequence:CCGGCAAGAACTACATCAAATCGCTCTCGAGAGCGATTTGATGTAGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-282s1c1
Sequence:CCGGGCACAAGCTAAATAACGCCTTCTCGAGAAGGCGTTATTTAGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-390s1c1
Sequence:CCGGCAAATCGCTGACGGCCACCATCTCGAGATGGTGGCCGTCAGCGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-222s1c1
Sequence:CCGGCCGTCGTGACAGCAGCATCCACTCGAGTGGATGCTGCTGTCACGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177455
BHLHA15 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member a15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-276s1c1
Sequence:CCGGGCGGATGCACAAGCTAAATAACTCGAGTTATTTAGCTTGTGCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-378s1c1
Sequence:CCGGCAAGAACTACATCAAATCGCTCTCGAGAGCGATTTGATGTAGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-282s1c1
Sequence:CCGGGCACAAGCTAAATAACGCCTTCTCGAGAAGGCGTTATTTAGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-390s1c1
Sequence:CCGGCAAATCGCTGACGGCCACCATCTCGAGATGGTGGCCGTCAGCGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-222s1c1
Sequence:CCGGCCGTCGTGACAGCAGCATCCACTCGAGTGGATGCTGCTGTCACGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177455
BHLHA15 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member a15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-276s1c1
Sequence:CCGGGCGGATGCACAAGCTAAATAACTCGAGTTATTTAGCTTGTGCATCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-378s1c1
Sequence:CCGGCAAGAACTACATCAAATCGCTCTCGAGAGCGATTTGATGTAGTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-282s1c1
Sequence:CCGGGCACAAGCTAAATAACGCCTTCTCGAGAAGGCGTTATTTAGCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-390s1c1
Sequence:CCGGCAAATCGCTGACGGCCACCATCTCGAGATGGTGGCCGTCAGCGATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177455.2-222s1c1
Sequence:CCGGCCGTCGTGACAGCAGCATCCACTCGAGTGGATGCTGCTGTCACGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010800
BHLHA15 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member a15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-515s1c1
Sequence:CCGGCCCTAAATTATACCAGCACTACTCGAGTAGTGCTGGTATAATTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-623s1c1
Sequence:CCGGGCAACGCTACTCTACACAGATCTCGAGATCTGTGTAGAGTAGCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-324s1c1
Sequence:CCGGCGGATGCATAAACTCAACAATCTCGAGATTGTTGAGTTTATGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-448s1c1
Sequence:CCGGCCGCCACCATACTTACTATGTCTCGAGACATAGTAAGTATGGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-616s1c1
Sequence:CCGGGCCACCTGCAACGCTACTCTACTCGAGTAGAGTAGCGTTGCAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010800
BHLHA15 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member a15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-515s1c1
Sequence:CCGGCCCTAAATTATACCAGCACTACTCGAGTAGTGCTGGTATAATTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-623s1c1
Sequence:CCGGGCAACGCTACTCTACACAGATCTCGAGATCTGTGTAGAGTAGCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-324s1c1
Sequence:CCGGCGGATGCATAAACTCAACAATCTCGAGATTGTTGAGTTTATGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-448s1c1
Sequence:CCGGCCGCCACCATACTTACTATGTCTCGAGACATAGTAAGTATGGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-616s1c1
Sequence:CCGGGCCACCTGCAACGCTACTCTACTCGAGTAGAGTAGCGTTGCAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010800
BHLHA15 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member a15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-515s1c1
Sequence:CCGGCCCTAAATTATACCAGCACTACTCGAGTAGTGCTGGTATAATTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-623s1c1
Sequence:CCGGGCAACGCTACTCTACACAGATCTCGAGATCTGTGTAGAGTAGCGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-324s1c1
Sequence:CCGGCGGATGCATAAACTCAACAATCTCGAGATTGTTGAGTTTATGCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-448s1c1
Sequence:CCGGCCGCCACCATACTTACTATGTCTCGAGACATAGTAAGTATGGTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010800.2-616s1c1
Sequence:CCGGGCCACCTGCAACGCTACTCTACTCGAGTAGAGTAGCGTTGCAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks