EMAIL THIS PAGE TO A FRIEND

BHLHA9

basic helix-loop-helix family, member a9

71 Gene Product Result for
Synonyms: BHLHF42
UniProtKB ID: Q7RTU4, A8MSH6
Gene ID:
Mouse(320522) basic helix-loop-helix family, member a9
Rat(363656) basic helix-loop-helix family, member a9
domestic guinea pig(100721520) basic helix-loop-helix family, member a9
naked mole-rat(101710494) basic helix-loop-helix family, member a9
sheep(101123055) basic helix-loop-helix family, member a9
Zebrafish(323481) basic helix-loop-helix family, member a9
cow(100301293) basic helix-loop-helix family, member a9
domestic cat(101081267) basic helix-loop-helix family, member a9
dog(611122) basic helix-loop-helix family, member a9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023481 MISSION® esiRNA esiRNA targeting mouse Bhlha9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001125971 Rosetta Predictions human pricing
XM_001126841 Rosetta Predictions human pricing
XM_001716976 Rosetta Predictions human pricing
XM_001080761 Rosetta Predictions rat pricing
XM_343945 Rosetta Predictions rat pricing
NM_177182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001125971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00382255 predicted 285
2 SASI_Hs02_00382256 predicted 275
3 SASI_Hs02_00382257 predicted 334
4 SASI_Hs02_00382258 predicted 349
5 SASI_Hs02_00382259 predicted 279
6 SASI_Hs02_00382260 predicted 281
7 SASI_Hs02_00382261 predicted 283
8 SASI_Hs02_00382262 predicted 340
9 SASI_Hs02_00382263 predicted 484
10 SASI_Hs02_00382264 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383264 predicted 288
2 SASI_Hs02_00383265 predicted 280
3 SASI_Hs02_00383266 predicted 335
4 SASI_Hs02_00383267 predicted 353
5 SASI_Hs02_00383268 predicted 278
6 SASI_Hs02_00383269 predicted 280
7 SASI_Hs02_00383270 predicted 285
8 SASI_Hs02_00383271 predicted 340
9 SASI_Hs02_00383272 predicted 484
10 SASI_Hs02_00383273 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414184 predicted 281
2 SASI_Hs02_00414185 predicted 278
3 SASI_Hs02_00414186 predicted 341
4 SASI_Hs02_00414187 predicted 346
5 SASI_Hs02_00414188 predicted 275
6 SASI_Hs02_00414189 predicted 281
7 SASI_Hs02_00414190 predicted 276
8 SASI_Hs02_00414191 predicted 338
9 SASI_Hs02_00414192 predicted 482
10 SASI_Hs02_00414193 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369222 predicted 221
2 SASI_Rn02_00369223 predicted 270
3 SASI_Rn02_00369224 predicted 268
4 SASI_Rn02_00369225 predicted 269
5 SASI_Rn02_00369226 predicted 199
6 SASI_Rn02_00369227 predicted 374
7 SASI_Rn02_00369228 predicted 368
8 SASI_Rn02_00369229 predicted 216
9 SASI_Rn02_00369230 predicted 272
10 SASI_Rn02_00369231 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396585 predicted 217
2 SASI_Rn02_00396586 predicted 270
3 SASI_Rn02_00396587 predicted 265
4 SASI_Rn02_00396588 predicted 273
5 SASI_Rn02_00396589 predicted 198
6 SASI_Rn02_00396590 predicted 371
7 SASI_Rn02_00396591 predicted 374
8 SASI_Rn02_00396592 predicted 217
9 SASI_Rn02_00396593 predicted 271
10 SASI_Rn02_00396594 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175926 predicted 397
2 SASI_Mm01_00175927 predicted 872
3 SASI_Mm01_00175929 predicted 834
4 SASI_Mm01_00175930 predicted 861
5 SASI_Mm02_00347169 predicted 889
6 SASI_Mm01_00175931 predicted 883
7 SASI_Mm01_00175932 predicted 533
8 SASI_Mm01_00175933 predicted 594
9 SASI_Mm01_00175934 predicted 398
10 SASI_Mm01_00175935 predicted 297
11 SASI_Mm01_00175928 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177182
BHLHA9 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member a9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177182.3-879s1c1
Sequence:CCGGGTGGCAAAGGAGGATGTCTTACTCGAGTAAGACATCCTCCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-652s1c1
Sequence:CCGGGATGGCCGAAGTGCCCAATTTCTCGAGAAATTGGGCACTTCGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-301s1c1
Sequence:CCGGCCTGGATTACAACGAGGCGTTCTCGAGAACGCCTCGTTGTAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-537s1c1
Sequence:CCGGCGCCGTCTCCTATAGCGCCTACTCGAGTAGGCGCTATAGGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-403s1c1
Sequence:CCGGCCGCATCACTGCTCTATCCTTCTCGAGAAGGATAGAGCAGTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177182
BHLHA9 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member a9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177182.3-879s1c1
Sequence:CCGGGTGGCAAAGGAGGATGTCTTACTCGAGTAAGACATCCTCCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-652s1c1
Sequence:CCGGGATGGCCGAAGTGCCCAATTTCTCGAGAAATTGGGCACTTCGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-301s1c1
Sequence:CCGGCCTGGATTACAACGAGGCGTTCTCGAGAACGCCTCGTTGTAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-537s1c1
Sequence:CCGGCGCCGTCTCCTATAGCGCCTACTCGAGTAGGCGCTATAGGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-403s1c1
Sequence:CCGGCCGCATCACTGCTCTATCCTTCTCGAGAAGGATAGAGCAGTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177182
BHLHA9 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member a9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177182.3-879s1c1
Sequence:CCGGGTGGCAAAGGAGGATGTCTTACTCGAGTAAGACATCCTCCTTTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-652s1c1
Sequence:CCGGGATGGCCGAAGTGCCCAATTTCTCGAGAAATTGGGCACTTCGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-301s1c1
Sequence:CCGGCCTGGATTACAACGAGGCGTTCTCGAGAACGCCTCGTTGTAATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-537s1c1
Sequence:CCGGCGCCGTCTCCTATAGCGCCTACTCGAGTAGGCGCTATAGGAGACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177182.3-403s1c1
Sequence:CCGGCCGCATCACTGCTCTATCCTTCTCGAGAAGGATAGAGCAGTGATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks