EMAIL THIS PAGE TO A FRIEND

BHLHB9

basic helix-loop-helix domain containing, class B, 9

155 Gene Product Result for
Synonyms: p60TRP
UniProtKB ID: Q6PI77, Q9C0G2
Gene ID:
Human(80823) Summary: This gene is a member of a gene family which encodes proteins with a basic helix-loop-helix domain. Other members of this gene family encode proteins which function as transcription factors, either enhancing or inhibiting transcription depending on the activity of other DNA binding proteins. The coding region of this gene is located entirely within the terminal exon. The encoded protein may be involved in the survival of neurons (PMID: 15034937). Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2011]
Mouse(70237) basic helix-loop-helix domain containing, class B9
Rat(317407) basic helix-loop-helix domain containing, class B, 9
domestic guinea pig(100716458) basic helix-loop-helix domain containing, class B, 9
sheep(101123275) basic helix-loop-helix domain containing, class B, 9
Domestic Rabbit(100339521) basic helix-loop-helix domain containing, class B, 9
dog(480997) basic helix-loop-helix domain containing, class B, 9
cow(100139620) basic helix-loop-helix domain containing, class B, 9
domestic cat(101091269) basic helix-loop-helix domain containing, class B, 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030639 Rosetta Predictions human pricing
NM_207611 Rosetta Predictions rat pricing
NM_001098222 Rosetta Predictions mouse pricing
NM_198161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358214 predicted 1475
2 SASI_Hs01_00132649 predicted 1525
3 SASI_Hs01_00132650 predicted 2077
4 SASI_Hs01_00132651 predicted 2236
5 SASI_Hs01_00132653 predicted 670
6 SASI_Hs02_00358215 predicted 2094
7 SASI_Hs01_00132654 predicted 1506
8 SASI_Hs01_00132655 predicted 1799
9 SASI_Hs01_00132656 predicted 548
10 SASI_Hs01_00132658 predicted 1434
11 SASI_Hs01_00132652 predicted 2055
12 SASI_Hs01_00132657 predicted 2228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066836 predicted 1598
2 SASI_Rn01_00066837 predicted 1611
3 SASI_Rn01_00066839 predicted 913
4 SASI_Rn01_00066840 predicted 1035
5 SASI_Rn01_00066841 predicted 303
6 SASI_Rn01_00066842 predicted 1098
7 SASI_Rn01_00066843 predicted 1004
8 SASI_Rn01_00066844 predicted 1084
9 SASI_Rn02_00270440 predicted 432
10 SASI_Rn01_00066845 predicted 734
11 SASI_Rn01_00066838 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301267 predicted 1001
2 SASI_Mm02_00301268 predicted 1116
3 SASI_Mm02_00301269 predicted 1727
4 SASI_Mm02_00301270 predicted 1779
5 SASI_Mm02_00301271 predicted 1426
6 SASI_Mm02_00301272 predicted 1936
7 SASI_Mm02_00301273 predicted 2290
8 SASI_Mm02_00301274 predicted 2299
9 SASI_Mm02_00301275 predicted 1592
10 SASI_Mm02_00301276 predicted 1811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030580 predicted 1010
2 SASI_Mm02_00350871 predicted 1135
3 SASI_Mm01_00030581 predicted 1738
4 SASI_Mm01_00030582 predicted 1790
5 SASI_Mm01_00030583 predicted 1439
6 SASI_Mm01_00030584 predicted 1944
7 SASI_Mm01_00030586 predicted 2305
8 SASI_Mm01_00030587 predicted 2316
9 SASI_Mm01_00030588 predicted 1594
10 SASI_Mm01_00030589 predicted 1821
11 SASI_Mm01_00030585 predicted 1277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030639
BHLHB9 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix domain containing, class B, 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-2007s1c1
Sequence:CCGGCTTTAACCAGAAAGAGGCAAACTCGAGTTTGCCTCTTTCTGGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168148    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030639.1-2968s1c1
Sequence:CCGGCCAATGAGAATTAGAGAGGTTCTCGAGAACCTCTCTAATTCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-706s1c1
Sequence:CCGGGCAGTGTCTAAGAACAAGGTTCTCGAGAACCTTGTTCTTAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-1597s1c1
Sequence:CCGGGCCCAAGAGTTTATTAACGAACTCGAGTTCGTTAATAAACTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030639.1-3165s1c1
Sequence:CCGGGCCAGGTGTTACAATTCTTAACTCGAGTTAAGAATTGTAACACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-1174s1c1
Sequence:CCGGGAGGTAACTATCTGGCCCAATCTCGAGATTGGGCCAGATAGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030639.2-2635s21c1
Sequence:CCGGGGAGTTCCTATAGGCTATTTACTCGAGTAAATAGCCTATAGGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030639.2-2051s21c1
Sequence:CCGGTTAGTGGTGTGGCCATATTTACTCGAGTAAATATGGCCACACCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030639
BHLHB9 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix domain containing, class B, 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-2007s1c1
Sequence:CCGGCTTTAACCAGAAAGAGGCAAACTCGAGTTTGCCTCTTTCTGGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168148    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030639.1-2968s1c1
Sequence:CCGGCCAATGAGAATTAGAGAGGTTCTCGAGAACCTCTCTAATTCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-706s1c1
Sequence:CCGGGCAGTGTCTAAGAACAAGGTTCTCGAGAACCTTGTTCTTAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-1597s1c1
Sequence:CCGGGCCCAAGAGTTTATTAACGAACTCGAGTTCGTTAATAAACTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030639.1-3165s1c1
Sequence:CCGGGCCAGGTGTTACAATTCTTAACTCGAGTTAAGAATTGTAACACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-1174s1c1
Sequence:CCGGGAGGTAACTATCTGGCCCAATCTCGAGATTGGGCCAGATAGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030639.2-2635s21c1
Sequence:CCGGGGAGTTCCTATAGGCTATTTACTCGAGTAAATAGCCTATAGGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030639.2-2051s21c1
Sequence:CCGGTTAGTGGTGTGGCCATATTTACTCGAGTAAATATGGCCACACCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030639
BHLHB9 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix domain containing, class B, 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-2007s1c1
Sequence:CCGGCTTTAACCAGAAAGAGGCAAACTCGAGTTTGCCTCTTTCTGGTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168148    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030639.1-2968s1c1
Sequence:CCGGCCAATGAGAATTAGAGAGGTTCTCGAGAACCTCTCTAATTCTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-706s1c1
Sequence:CCGGGCAGTGTCTAAGAACAAGGTTCTCGAGAACCTTGTTCTTAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-1597s1c1
Sequence:CCGGGCCCAAGAGTTTATTAACGAACTCGAGTTCGTTAATAAACTCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168798    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030639.1-3165s1c1
Sequence:CCGGGCCAGGTGTTACAATTCTTAACTCGAGTTAAGAATTGTAACACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030639.1-1174s1c1
Sequence:CCGGGAGGTAACTATCTGGCCCAATCTCGAGATTGGGCCAGATAGTTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030639.2-2635s21c1
Sequence:CCGGGGAGTTCCTATAGGCTATTTACTCGAGTAAATAGCCTATAGGAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030639.2-2051s21c1
Sequence:CCGGTTAGTGGTGTGGCCATATTTACTCGAGTAAATATGGCCACACCACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198161
BHLHB9 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix domain containing, class B, 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198161.1-406s1c1
Sequence:CCGGCCATAGGACTGAGAACAAGTTCTCGAGAACTTGTTCTCAGTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198161.1-1908s1c1
Sequence:CCGGCTAGCTCAAAGCTAGACCATTCTCGAGAATGGTCTAGCTTTGAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198161.1-1209s1c1
Sequence:CCGGGCGTGGTGACACTTATTGAAACTCGAGTTTCAATAAGTGTCACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198161.1-1766s1c1
Sequence:CCGGCCAGAAATTAAAGAGAACACTCTCGAGAGTGTTCTCTTTAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.1-476s1c1
Sequence:CCGGGCTGGAGAAGATTCTGGTATTCTCGAGAATACCAGAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-2350s1c1
Sequence:CCGGCAATACTCTTACAGCCATATTCTCGAGAATATGGCTGTAAGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-1791s1c1
Sequence:CCGGCACAGATTGCAATGGGTATACCTCGAGGTATACCCATTGCAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-1283s1c1
Sequence:CCGGGAGGAGGAAGAGAACGTTATTCTCGAGAATAACGTTCTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198161
BHLHB9 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix domain containing, class B, 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198161.1-406s1c1
Sequence:CCGGCCATAGGACTGAGAACAAGTTCTCGAGAACTTGTTCTCAGTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198161.1-1908s1c1
Sequence:CCGGCTAGCTCAAAGCTAGACCATTCTCGAGAATGGTCTAGCTTTGAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198161.1-1209s1c1
Sequence:CCGGGCGTGGTGACACTTATTGAAACTCGAGTTTCAATAAGTGTCACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198161.1-1766s1c1
Sequence:CCGGCCAGAAATTAAAGAGAACACTCTCGAGAGTGTTCTCTTTAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.1-476s1c1
Sequence:CCGGGCTGGAGAAGATTCTGGTATTCTCGAGAATACCAGAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-2350s1c1
Sequence:CCGGCAATACTCTTACAGCCATATTCTCGAGAATATGGCTGTAAGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-1791s1c1
Sequence:CCGGCACAGATTGCAATGGGTATACCTCGAGGTATACCCATTGCAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-1283s1c1
Sequence:CCGGGAGGAGGAAGAGAACGTTATTCTCGAGAATAACGTTCTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198161
BHLHB9 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix domain containing, class B, 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198161.1-406s1c1
Sequence:CCGGCCATAGGACTGAGAACAAGTTCTCGAGAACTTGTTCTCAGTCCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176315    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198161.1-1908s1c1
Sequence:CCGGCTAGCTCAAAGCTAGACCATTCTCGAGAATGGTCTAGCTTTGAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198161.1-1209s1c1
Sequence:CCGGGCGTGGTGACACTTATTGAAACTCGAGTTTCAATAAGTGTCACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174307    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198161.1-1766s1c1
Sequence:CCGGCCAGAAATTAAAGAGAACACTCTCGAGAGTGTTCTCTTTAATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.1-476s1c1
Sequence:CCGGGCTGGAGAAGATTCTGGTATTCTCGAGAATACCAGAATCTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-2350s1c1
Sequence:CCGGCAATACTCTTACAGCCATATTCTCGAGAATATGGCTGTAAGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-1791s1c1
Sequence:CCGGCACAGATTGCAATGGGTATACCTCGAGGTATACCCATTGCAATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198161.2-1283s1c1
Sequence:CCGGGAGGAGGAAGAGAACGTTATTCTCGAGAATAACGTTCTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks