EMAIL THIS PAGE TO A FRIEND

BHLHE22

basic helix-loop-helix family, member e22

154 Gene Product Result for
Synonyms: BHLHB5 Beta3 CAGL85 TNRC20
UniProtKB ID: Q8NFJ8
Gene ID:
Human(27319) Summary: BHLHE22 belongs to the basic helix-loop-helix (bHLH) family of transcription factors that regulate cell fate determination, proliferation, and differentiation. These proteins function as dimers and bind to an E-box DNA sequence (CANNTG). BHLHE22 is expressed exclusively in the central nervous system and retina (Xu et al., 2002 [PubMed 12213201]
Mouse(59058) basic helix-loop-helix family, member e22
Rat(365748) basic helix-loop-helix family, member e22
Zebrafish(393930) basic helix-loop-helix family, member e22
domestic cat(101086624) basic helix-loop-helix family, member e22
sheep(101112909) basic helix-loop-helix family, member e22
naked mole-rat(101721911) basic helix-loop-helix family, member e22
domestic guinea pig(100717797) basic helix-loop-helix family, member e22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152414 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033241 MISSION® esiRNA esiRNA targeting mouse Bhlhe22 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152414 Rosetta Predictions human pricing
NM_001108940 Rosetta Predictions rat pricing
NM_021560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209990 predicted 1605
2 SASI_Hs01_00209991 predicted 1607
3 SASI_Hs01_00209992 predicted 1608
4 SASI_Hs02_00366122 predicted 1810
5 SASI_Hs01_00209993 predicted 1666
6 SASI_Hs01_00209994 predicted 2139
7 SASI_Hs01_00209995 predicted 2005
8 SASI_Hs01_00209997 predicted 1802
9 SASI_Hs01_00209998 predicted 1654
10 SASI_Hs02_00366123 predicted 2020
11 SASI_Hs01_00209996 predicted 2138
12 SASI_Hs01_00209999 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243584 predicted 1893
2 SASI_Rn02_00243585 predicted 1667
3 SASI_Rn02_00243586 predicted 1424
4 SASI_Rn02_00243587 predicted 1530
5 SASI_Rn02_00243588 predicted 1578
6 SASI_Rn02_00243589 predicted 1383
7 SASI_Rn02_00243590 predicted 1562
8 SASI_Rn02_00243591 predicted 1720
9 SASI_Rn02_00243592 predicted 1595
10 SASI_Rn02_00243593 predicted 1478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326342 predicted 2024
2 SASI_Mm01_00167560 predicted 1511
3 SASI_Mm02_00326343 predicted 1809
4 SASI_Mm01_00167562 predicted 1863
5 SASI_Mm01_00167563 predicted 1521
6 SASI_Mm01_00167564 predicted 1985
7 SASI_Mm01_00167565 predicted 1664
8 SASI_Mm01_00167566 predicted 1678
9 SASI_Mm01_00167567 predicted 1633
10 SASI_Mm02_00326344 predicted 1658
11 SASI_Mm01_00167561 predicted 1734
12 SASI_Mm01_00167568 predicted 1585
13 SASI_Mm01_00167569 predicted 1558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152414
BHLHE22 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152414.3-1449s21c1
Sequence:CCGGCCTAGTCGCCTACCTCAACCACTCGAGTGGTTGAGGTAGGCGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152414.3-2067s21c1
Sequence:CCGGCCTACTAATAATTGTGGATTTCTCGAGAAATCCACAATTATTAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152414.3-2127s21c1
Sequence:CCGGTAGCATGAGAGATGGAATATTCTCGAGAATATTCCATCTCTCATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152414.3-1661s21c1
Sequence:CCGGAGTGCACGGAGAAGCCTTAAACTCGAGTTTAAGGCTTCTCCGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152414.3-2606s1c1
Sequence:CCGGGCCAACAAGTATGAAGAGAAACTCGAGTTTCTCTTCATACTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-1611s1c1
Sequence:CCGGCCCGGAGAAGTGCGCCCTGTTCTCGAGAACAGGGCGCACTTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-618s1c1
Sequence:CCGGCAAGCGCTTGGAAGCGGCTTTCTCGAGAAAGCCGCTTCCAAGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-907s1c1
Sequence:CCGGCTTTGCCTCAAGTACGGCGAACTCGAGTTCGCCGTACTTGAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-1266s1c1
Sequence:CCGGGCTTAACATCAATGCCCGAGACTCGAGTCTCGGGCATTGATGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152414
BHLHE22 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152414.3-1449s21c1
Sequence:CCGGCCTAGTCGCCTACCTCAACCACTCGAGTGGTTGAGGTAGGCGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152414.3-2067s21c1
Sequence:CCGGCCTACTAATAATTGTGGATTTCTCGAGAAATCCACAATTATTAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152414.3-2127s21c1
Sequence:CCGGTAGCATGAGAGATGGAATATTCTCGAGAATATTCCATCTCTCATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152414.3-1661s21c1
Sequence:CCGGAGTGCACGGAGAAGCCTTAAACTCGAGTTTAAGGCTTCTCCGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152414.3-2606s1c1
Sequence:CCGGGCCAACAAGTATGAAGAGAAACTCGAGTTTCTCTTCATACTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-1611s1c1
Sequence:CCGGCCCGGAGAAGTGCGCCCTGTTCTCGAGAACAGGGCGCACTTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-618s1c1
Sequence:CCGGCAAGCGCTTGGAAGCGGCTTTCTCGAGAAAGCCGCTTCCAAGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-907s1c1
Sequence:CCGGCTTTGCCTCAAGTACGGCGAACTCGAGTTCGCCGTACTTGAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-1266s1c1
Sequence:CCGGGCTTAACATCAATGCCCGAGACTCGAGTCTCGGGCATTGATGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152414
BHLHE22 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152414.3-1449s21c1
Sequence:CCGGCCTAGTCGCCTACCTCAACCACTCGAGTGGTTGAGGTAGGCGACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425660    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152414.3-2067s21c1
Sequence:CCGGCCTACTAATAATTGTGGATTTCTCGAGAAATCCACAATTATTAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152414.3-2127s21c1
Sequence:CCGGTAGCATGAGAGATGGAATATTCTCGAGAATATTCCATCTCTCATGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152414.3-1661s21c1
Sequence:CCGGAGTGCACGGAGAAGCCTTAAACTCGAGTTTAAGGCTTCTCCGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152414.3-2606s1c1
Sequence:CCGGGCCAACAAGTATGAAGAGAAACTCGAGTTTCTCTTCATACTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-1611s1c1
Sequence:CCGGCCCGGAGAAGTGCGCCCTGTTCTCGAGAACAGGGCGCACTTCTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-618s1c1
Sequence:CCGGCAAGCGCTTGGAAGCGGCTTTCTCGAGAAAGCCGCTTCCAAGCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-907s1c1
Sequence:CCGGCTTTGCCTCAAGTACGGCGAACTCGAGTTCGCCGTACTTGAGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152414.3-1266s1c1
Sequence:CCGGGCTTAACATCAATGCCCGAGACTCGAGTCTCGGGCATTGATGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021560
VALIDATED
BHLHE22 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e22
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021560.4-2300s21c1
Sequence:GTACCGGGATCCACATCAACCGTATTTACTCGAGTAAATACGGTTGATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1512s21c1
Sequence:CCGGAGTGCACGGAGAAGCCTTAAACTCGAGTTTAAGGCTTCTCCGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1211s21c1
Sequence:CCGGTCAGTGCGGAAGCTCTCCAAACTCGAGTTTGGAGAGCTTCCGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1186s21c1
Sequence:CCGGGGTCATTCCTTACGCGCACAGCTCGAGCTGTGCGCGTAAGGAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1464s21c1
Sequence:CCGGCCGAGAAGTGTGCCCTATTCACTCGAGTGAATAGGGCACACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021560.2-2352s1c1
Sequence:CCGGGCCAACAAATATGAAGAGAAACTCGAGTTTCTCTTCATATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021560.2-1029s1c1
Sequence:CCGGGAAGGCGTTGCGCCTCAACATCTCGAGATGTTGAGGCGCAACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021560.2-420s1c1
Sequence:CCGGCGCGAGCGAAGACGACCTCTTCTCGAGAAGAGGTCGTCTTCGCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021560
VALIDATED
BHLHE22 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e22
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021560.4-2300s21c1
Sequence:GTACCGGGATCCACATCAACCGTATTTACTCGAGTAAATACGGTTGATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1512s21c1
Sequence:CCGGAGTGCACGGAGAAGCCTTAAACTCGAGTTTAAGGCTTCTCCGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1211s21c1
Sequence:CCGGTCAGTGCGGAAGCTCTCCAAACTCGAGTTTGGAGAGCTTCCGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1186s21c1
Sequence:CCGGGGTCATTCCTTACGCGCACAGCTCGAGCTGTGCGCGTAAGGAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1464s21c1
Sequence:CCGGCCGAGAAGTGTGCCCTATTCACTCGAGTGAATAGGGCACACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021560.2-2352s1c1
Sequence:CCGGGCCAACAAATATGAAGAGAAACTCGAGTTTCTCTTCATATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021560.2-1029s1c1
Sequence:CCGGGAAGGCGTTGCGCCTCAACATCTCGAGATGTTGAGGCGCAACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021560.2-420s1c1
Sequence:CCGGCGCGAGCGAAGACGACCTCTTCTCGAGAAGAGGTCGTCTTCGCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021560
VALIDATED
BHLHE22 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e22
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021560.4-2300s21c1
Sequence:GTACCGGGATCCACATCAACCGTATTTACTCGAGTAAATACGGTTGATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1512s21c1
Sequence:CCGGAGTGCACGGAGAAGCCTTAAACTCGAGTTTAAGGCTTCTCCGTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1211s21c1
Sequence:CCGGTCAGTGCGGAAGCTCTCCAAACTCGAGTTTGGAGAGCTTCCGCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1186s21c1
Sequence:CCGGGGTCATTCCTTACGCGCACAGCTCGAGCTGTGCGCGTAAGGAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021560.4-1464s21c1
Sequence:CCGGCCGAGAAGTGTGCCCTATTCACTCGAGTGAATAGGGCACACTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021560.2-2352s1c1
Sequence:CCGGGCCAACAAATATGAAGAGAAACTCGAGTTTCTCTTCATATTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021560.2-1029s1c1
Sequence:CCGGGAAGGCGTTGCGCCTCAACATCTCGAGATGTTGAGGCGCAACGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021560.2-420s1c1
Sequence:CCGGCGCGAGCGAAGACGACCTCTTCTCGAGAAGAGGTCGTCTTCGCTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks