EMAIL THIS PAGE TO A FRIEND

BHLHE23

basic helix-loop-helix family, member e23

42 Gene Product Result for
Synonyms: BETA4 BHLHB4 bA305P22.3
UniProtKB ID: Q8NDY6, B2RP69
Gene ID:
Human(128408) Summary: This gene encodes a member of the basic helix-loop-helix transcription factor family. Members of this family contain two highly conserved and functionally distinct domains: the basic domain targets sequence-specific DNA binding, while the helix-loop-helix domain facilitates protein interaction. Studies of a related gene in mouse suggest that the encoded protein may function as a transcriptional repressor in the pancreas and brain, and that it is required for normal retinal function. [provided by RefSeq, May 2013]
Mouse(140489) basic helix-loop-helix family, member e23
Rat(499952) basic helix-loop-helix family, member e23
domestic guinea pig(100717990) basic helix-loop-helix family, member e23
naked mole-rat(101709444) basic helix-loop-helix family, member e23
sheep(101119410) basic helix-loop-helix family, member e23
Zebrafish(559796) basic helix-loop-helix family, member e23
dog(485967) basic helix-loop-helix family, member e23
cow(539207) basic helix-loop-helix family, member e23
chicken(395165) basic helix-loop-helix family, member e23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083921 MISSION® esiRNA esiRNA targeting mouse Bhlhe23 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080606 Rosetta Predictions human pricing
NM_001109211 Rosetta Predictions rat pricing
NM_080641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362344 predicted 367
2 SASI_Hs02_00362345 predicted 777
3 SASI_Hs02_00362346 predicted 899
4 SASI_Hs02_00362347 predicted 867
5 SASI_Hs02_00362348 predicted 893
6 SASI_Hs02_00362349 predicted 780
7 SASI_Hs02_00362350 predicted 322
8 SASI_Hs02_00362351 predicted 618
9 SASI_Hs02_00362352 predicted 896
10 SASI_Hs02_00362353 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109211 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246180 predicted 754
2 SASI_Rn02_00246181 predicted 844
3 SASI_Rn02_00246182 predicted 994
4 SASI_Rn02_00246183 predicted 852
5 SASI_Rn02_00246184 predicted 781
6 SASI_Rn02_00246185 predicted 1270
7 SASI_Rn02_00246186 predicted 692
8 SASI_Rn02_00246187 predicted 1114
9 SASI_Rn02_00246188 predicted 1241
10 SASI_Rn02_00246189 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051530 predicted 849
2 SASI_Mm01_00051531 predicted 1232
3 SASI_Mm01_00051532 predicted 960
4 SASI_Mm01_00051533 predicted 1032
5 SASI_Mm01_00051534 predicted 1310
6 SASI_Mm02_00338198 predicted 993
7 SASI_Mm01_00051535 predicted 808
8 SASI_Mm01_00051536 predicted 882
9 SASI_Mm01_00051537 predicted 699
10 SASI_Mm01_00051538 predicted 760
11 SASI_Mm01_00051529 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080606
BHLHE23 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e23
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-300s1c1
Sequence:CCGGCCTGGCACTAAGCCACGGCTACTCGAGTAGCCGTGGCTTAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-696s1c1
Sequence:CCGGGCTGCTCGCCAAGAACTATATCTCGAGATATAGTTCTTGGCGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-702s1c1
Sequence:CCGGCGCCAAGAACTATATCCTCATCTCGAGATGAGGATATAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-705s1c1
Sequence:CCGGCAAGAACTATATCCTCATGCACTCGAGTGCATGAGGATATAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-699s1c1
Sequence:CCGGGCTCGCCAAGAACTATATCCTCTCGAGAGGATATAGTTCTTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080606
BHLHE23 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e23
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-300s1c1
Sequence:CCGGCCTGGCACTAAGCCACGGCTACTCGAGTAGCCGTGGCTTAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-696s1c1
Sequence:CCGGGCTGCTCGCCAAGAACTATATCTCGAGATATAGTTCTTGGCGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-702s1c1
Sequence:CCGGCGCCAAGAACTATATCCTCATCTCGAGATGAGGATATAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-705s1c1
Sequence:CCGGCAAGAACTATATCCTCATGCACTCGAGTGCATGAGGATATAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-699s1c1
Sequence:CCGGGCTCGCCAAGAACTATATCCTCTCGAGAGGATATAGTTCTTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080606
BHLHE23 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e23
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-300s1c1
Sequence:CCGGCCTGGCACTAAGCCACGGCTACTCGAGTAGCCGTGGCTTAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-696s1c1
Sequence:CCGGGCTGCTCGCCAAGAACTATATCTCGAGATATAGTTCTTGGCGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-702s1c1
Sequence:CCGGCGCCAAGAACTATATCCTCATCTCGAGATGAGGATATAGTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-705s1c1
Sequence:CCGGCAAGAACTATATCCTCATGCACTCGAGTGCATGAGGATATAGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080606.2-699s1c1
Sequence:CCGGGCTCGCCAAGAACTATATCCTCTCGAGAGGATATAGTTCTTGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080641
BHLHE23 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080641.3-853s1c1
Sequence:CCGGCGCCTTTCTATTTAGACTGTTCTCGAGAACAGTCTAAATAGAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-761s1c1
Sequence:CCGGCCCAGACAAGTGTGCCACCTTCTCGAGAAGGTGGCACACTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-564s1c1
Sequence:CCGGCTCTCCAAGATAGCCACACTTCTCGAGAAGTGTGGCTATCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-482s1c1
Sequence:CCGGGCGACGCATGCATGACCTGAACTCGAGTTCAGGTCATGCATGCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-638s1c1
Sequence:CCGGGCGCTTGGTAGCATACCTCAACTCGAGTTGAGGTATGCTACCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080641
BHLHE23 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080641.3-853s1c1
Sequence:CCGGCGCCTTTCTATTTAGACTGTTCTCGAGAACAGTCTAAATAGAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-761s1c1
Sequence:CCGGCCCAGACAAGTGTGCCACCTTCTCGAGAAGGTGGCACACTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-564s1c1
Sequence:CCGGCTCTCCAAGATAGCCACACTTCTCGAGAAGTGTGGCTATCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-482s1c1
Sequence:CCGGGCGACGCATGCATGACCTGAACTCGAGTTCAGGTCATGCATGCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-638s1c1
Sequence:CCGGGCGCTTGGTAGCATACCTCAACTCGAGTTGAGGTATGCTACCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080641
BHLHE23 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080641.3-853s1c1
Sequence:CCGGCGCCTTTCTATTTAGACTGTTCTCGAGAACAGTCTAAATAGAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-761s1c1
Sequence:CCGGCCCAGACAAGTGTGCCACCTTCTCGAGAAGGTGGCACACTTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-564s1c1
Sequence:CCGGCTCTCCAAGATAGCCACACTTCTCGAGAAGTGTGGCTATCTTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-482s1c1
Sequence:CCGGGCGACGCATGCATGACCTGAACTCGAGTTCAGGTCATGCATGCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080641.3-638s1c1
Sequence:CCGGGCGCTTGGTAGCATACCTCAACTCGAGTTGAGGTATGCTACCAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks