EMAIL THIS PAGE TO A FRIEND

BHLHE40

basic helix-loop-helix family, member e40

143 Gene Product Result for
Synonyms: BHLHB2 DEC1 HLHB2 SHARP-2 STRA13 Stra14
UniProtKB ID: O14503, Q96TD3
Gene ID:
Human(8553) Summary: This gene encodes a basic helix-loop-helix protein expressed in various tissues. Expression in the chondrocytes is responsive to the addition of Bt2cAMP. The encoded protein is believed to be involved in the control of cell differentiation. [provided by RefSeq, Aug 2008]
Mouse(20893) basic helix-loop-helix family, member e40
Rat(79431) basic helix-loop-helix family, member e40
Zebrafish(324413) basic helix-loop-helix family, member e40
cow(506945) basic helix-loop-helix family, member e40
domestic cat(101101625) basic helix-loop-helix family, member e40
dog(484680) basic helix-loop-helix family, member e40
chicken(416108) basic helix-loop-helix family, member e40
sheep(100169939) basic helix-loop-helix family, member e40
naked mole-rat(101706879) basic helix-loop-helix family, member e40
domestic guinea pig(100734551) basic helix-loop-helix family, member e40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011498 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011498 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011498 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003670 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003670 Rosetta Predictions human pricing
NM_053328 Rosetta Predictions rat pricing
NM_011498 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157761 predicted 1914
2 SASI_Hs01_00157762 predicted 1012
3 SASI_Hs01_00157763 predicted 285
4 SASI_Hs01_00157764 predicted 507
5 SASI_Hs01_00157766 predicted 866
6 SASI_Hs02_00336054 predicted 1281
7 SASI_Hs01_00157767 predicted 1082
8 SASI_Hs01_00157770 predicted 928
9 SASI_Hs02_00336055 predicted 316
10 SASI_Hs02_00336056 predicted 775
11 SASI_Hs01_00157765 predicted 281
12 SASI_Hs01_00157768 predicted 445
13 SASI_Hs01_00157769 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053328 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036743 predicted 1311
2 SASI_Rn01_00036744 predicted 1255
3 SASI_Rn01_00036745 predicted 757
4 SASI_Rn01_00036747 predicted 2033
5 SASI_Rn01_00036748 predicted 621
6 SASI_Rn01_00036749 predicted 1186
7 SASI_Rn01_00036750 predicted 454
8 SASI_Rn01_00036751 predicted 779
9 SASI_Rn01_00036752 predicted 1042
10 SASI_Rn02_00265763 predicted 1288
11 SASI_Rn01_00036746 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011498 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115100 predicted 1148
2 SASI_Mm02_00320808 predicted 865
3 SASI_Mm01_00115101 predicted 411
4 SASI_Mm01_00115102 predicted 1274
5 SASI_Mm01_00115103 predicted 1093
6 SASI_Mm01_00115104 predicted 1322
7 SASI_Mm01_00115105 predicted 1010
8 SASI_Mm01_00115107 predicted 998
9 SASI_Mm01_00115108 predicted 644
10 SASI_Mm01_00115109 predicted 845
11 SASI_Mm01_00115106 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011498
VALIDATED
BHLHE40 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e40
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011498.2-2837s1c1
Sequence:CCGGGCGAGGTTACAGTGTTTATATCTCGAGATATAAACACTGTAACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011498.2-653s1c1
Sequence:CCGGGCGGTTTACAAGCTGGTGATTCTCGAGAATCACCAGCTTGTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-665s1c1
Sequence:CCGGCTGGTGATTTGTCGGGAAGAACTCGAGTTCTTCCCGACAAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-1108s1c1
Sequence:CCGGGTCAGCACAATTAAGCAAGAACTCGAGTTCTTGCTTAATTGTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-481s1c1
Sequence:CCGGGACCGGATTAACGAGTGCATTCTCGAGAATGCACTCGTTAATCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-580s21c1
Sequence:CCGGTTACGTTGAAGCACGTGAAAGCTCGAGCTTTCACGTGCTTCAACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-1100s21c1
Sequence:GTACCGGAGAACGTGTCAGCACAATTAACTCGAGTTAATTGTGCTGACACGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-2076s21c1
Sequence:CCGGGTAGTGGTTTGGGCAAATTTCCTCGAGGAAATTTGCCCAAACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011498.4-639s21c1
Sequence:CCGGATTGCCCTGCAGAGCGGTTTACTCGAGTAAACCGCTCTGCAGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-528s21c1
Sequence:CCGGCATCTCAAACTTACTACTTTGCTCGAGCAAAGTAGTAAGTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011498
VALIDATED
BHLHE40 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e40
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011498.2-2837s1c1
Sequence:CCGGGCGAGGTTACAGTGTTTATATCTCGAGATATAAACACTGTAACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011498.2-653s1c1
Sequence:CCGGGCGGTTTACAAGCTGGTGATTCTCGAGAATCACCAGCTTGTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-665s1c1
Sequence:CCGGCTGGTGATTTGTCGGGAAGAACTCGAGTTCTTCCCGACAAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-1108s1c1
Sequence:CCGGGTCAGCACAATTAAGCAAGAACTCGAGTTCTTGCTTAATTGTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-481s1c1
Sequence:CCGGGACCGGATTAACGAGTGCATTCTCGAGAATGCACTCGTTAATCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-580s21c1
Sequence:CCGGTTACGTTGAAGCACGTGAAAGCTCGAGCTTTCACGTGCTTCAACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-1100s21c1
Sequence:GTACCGGAGAACGTGTCAGCACAATTAACTCGAGTTAATTGTGCTGACACGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-2076s21c1
Sequence:CCGGGTAGTGGTTTGGGCAAATTTCCTCGAGGAAATTTGCCCAAACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011498.4-639s21c1
Sequence:CCGGATTGCCCTGCAGAGCGGTTTACTCGAGTAAACCGCTCTGCAGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-528s21c1
Sequence:CCGGCATCTCAAACTTACTACTTTGCTCGAGCAAAGTAGTAAGTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011498
VALIDATED
BHLHE40 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e40
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011498.2-2837s1c1
Sequence:CCGGGCGAGGTTACAGTGTTTATATCTCGAGATATAAACACTGTAACCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011498.2-653s1c1
Sequence:CCGGGCGGTTTACAAGCTGGTGATTCTCGAGAATCACCAGCTTGTAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-665s1c1
Sequence:CCGGCTGGTGATTTGTCGGGAAGAACTCGAGTTCTTCCCGACAAATCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-1108s1c1
Sequence:CCGGGTCAGCACAATTAAGCAAGAACTCGAGTTCTTGCTTAATTGTGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011498.2-481s1c1
Sequence:CCGGGACCGGATTAACGAGTGCATTCTCGAGAATGCACTCGTTAATCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-580s21c1
Sequence:CCGGTTACGTTGAAGCACGTGAAAGCTCGAGCTTTCACGTGCTTCAACGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-1100s21c1
Sequence:GTACCGGAGAACGTGTCAGCACAATTAACTCGAGTTAATTGTGCTGACACGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-2076s21c1
Sequence:CCGGGTAGTGGTTTGGGCAAATTTCCTCGAGGAAATTTGCCCAAACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011498.4-639s21c1
Sequence:CCGGATTGCCCTGCAGAGCGGTTTACTCGAGTAAACCGCTCTGCAGGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011498.4-528s21c1
Sequence:CCGGCATCTCAAACTTACTACTTTGCTCGAGCAAAGTAGTAAGTTTGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003670
VALIDATED
BHLHE40 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003670.1-2066s1c1
Sequence:CCGGCGGAAGAATAAAGAGAATGTACTCGAGTACATTCTCTTTATTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-1408s1c1
Sequence:CCGGCCCTTTAAACTTAGAAACCAACTCGAGTTGGTTTCTAAGTTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003670.1-512s1c1
Sequence:CCGGGCACTAACAAACCTAATTGATCTCGAGATCAATTAGGTTTGTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-435s1c1
Sequence:CCGGCCGAACATCTCAAACTTACAACTCGAGTTGTAAGTTTGAGATGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-1025s1c1
Sequence:CCGGGCAATTAAGCAAGAGTCCGAACTCGAGTTCGGACTCTTGCTTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-433s21c1
Sequence:CCGGACCCGAACATCTCAAACTTACCTCGAGGTAAGTTTGAGATGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003670.1-503s21c1
Sequence:CCGGCATGTGAAAGCACTAACAAACCTCGAGGTTTGTTAGTGCTTTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-1012s21c1
Sequence:CCGGAGAAAGGATCGGCGCAATTAACTCGAGTTAATTGCGCCGATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-1078s21c1
Sequence:CCGGTTCGGATGATGAAGGCCATTTCTCGAGAAATGGCCTTCATCATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003670.1-2105s21c1
Sequence:CCGGCGTAGTGATTAGCTTACTAAGCTCGAGCTTAGTAAGCTAATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003670
VALIDATED
BHLHE40 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003670.1-2066s1c1
Sequence:CCGGCGGAAGAATAAAGAGAATGTACTCGAGTACATTCTCTTTATTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-1408s1c1
Sequence:CCGGCCCTTTAAACTTAGAAACCAACTCGAGTTGGTTTCTAAGTTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003670.1-512s1c1
Sequence:CCGGGCACTAACAAACCTAATTGATCTCGAGATCAATTAGGTTTGTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-435s1c1
Sequence:CCGGCCGAACATCTCAAACTTACAACTCGAGTTGTAAGTTTGAGATGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-1025s1c1
Sequence:CCGGGCAATTAAGCAAGAGTCCGAACTCGAGTTCGGACTCTTGCTTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-433s21c1
Sequence:CCGGACCCGAACATCTCAAACTTACCTCGAGGTAAGTTTGAGATGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003670.1-503s21c1
Sequence:CCGGCATGTGAAAGCACTAACAAACCTCGAGGTTTGTTAGTGCTTTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-1012s21c1
Sequence:CCGGAGAAAGGATCGGCGCAATTAACTCGAGTTAATTGCGCCGATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-1078s21c1
Sequence:CCGGTTCGGATGATGAAGGCCATTTCTCGAGAAATGGCCTTCATCATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003670.1-2105s21c1
Sequence:CCGGCGTAGTGATTAGCTTACTAAGCTCGAGCTTAGTAAGCTAATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003670
VALIDATED
BHLHE40 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003670.1-2066s1c1
Sequence:CCGGCGGAAGAATAAAGAGAATGTACTCGAGTACATTCTCTTTATTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-1408s1c1
Sequence:CCGGCCCTTTAAACTTAGAAACCAACTCGAGTTGGTTTCTAAGTTTAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003670.1-512s1c1
Sequence:CCGGGCACTAACAAACCTAATTGATCTCGAGATCAATTAGGTTTGTTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-435s1c1
Sequence:CCGGCCGAACATCTCAAACTTACAACTCGAGTTGTAAGTTTGAGATGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003670.1-1025s1c1
Sequence:CCGGGCAATTAAGCAAGAGTCCGAACTCGAGTTCGGACTCTTGCTTAATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-433s21c1
Sequence:CCGGACCCGAACATCTCAAACTTACCTCGAGGTAAGTTTGAGATGTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003670.1-503s21c1
Sequence:CCGGCATGTGAAAGCACTAACAAACCTCGAGGTTTGTTAGTGCTTTCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-1012s21c1
Sequence:CCGGAGAAAGGATCGGCGCAATTAACTCGAGTTAATTGCGCCGATCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003670.1-1078s21c1
Sequence:CCGGTTCGGATGATGAAGGCCATTTCTCGAGAAATGGCCTTCATCATCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_003670.1-2105s21c1
Sequence:CCGGCGTAGTGATTAGCTTACTAAGCTCGAGCTTAGTAAGCTAATCACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks