EMAIL THIS PAGE TO A FRIEND

BHLHE41

basic helix-loop-helix family, member e41

144 Gene Product Result for
Synonyms: BHLHB3 DEC2 SHARP1 hDEC2
UniProtKB ID: Q9C0J9, A2I2N8
Gene ID:
Human(79365) Summary: This gene encodes a transcription factor that belongs to the Hairy/Enhancer of Split subfamily of basic helix-loop-helix factors. The encoded protein functions as a transcriptional repressor and as a regulator of molecular clock. Defects in this gene are associated with the short sleep phenotype. [provided by RefSeq, May 2010]
Mouse(79362) basic helix-loop-helix family, member e41
Rat(117095) basic helix-loop-helix family, member e41
Zebrafish(563771) basic helix-loop-helix family, member e41
cow(613907) basic helix-loop-helix family, member e41
domestic cat(101100733) basic helix-loop-helix family, member e41
dog(403457) basic helix-loop-helix family, member e41
chicken(101750689) basic helix-loop-helix family, member e41
chicken(101668037) basic helix-loop-helix family, member e41
domestic guinea pig(100723543) basic helix-loop-helix family, member e41
naked mole-rat(101717966) basic helix-loop-helix family, member e41
sheep(101112806) basic helix-loop-helix family, member e41
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030762 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016921 MISSION® esiRNA esiRNA targeting human BHLHB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030762 Rosetta Predictions human pricing
NM_133303 Rosetta Predictions rat pricing
XM_001074956 Rosetta Predictions rat pricing
XM_579618 Rosetta Predictions rat pricing
NM_024469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122458 predicted 300
2 SASI_Hs01_00122459 predicted 305
3 SASI_Hs01_00122460 predicted 298
4 SASI_Hs01_00122461 predicted 544
5 SASI_Hs01_00122462 predicted 390
6 SASI_Hs01_00122463 predicted 249
7 SASI_Hs01_00122465 predicted 386
8 SASI_Hs01_00122466 predicted 545
9 SASI_Hs01_00122467 predicted 513
10 SASI_Hs02_00358293 predicted 398
11 SASI_Hs01_00122464 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030484 predicted 649
2 SASI_Rn01_00030485 predicted 484
3 SASI_Rn01_00030486 predicted 397
4 SASI_Rn01_00030487 predicted 408
5 SASI_Rn01_00030488 predicted 498
6 SASI_Rn01_00030489 predicted 278
7 SASI_Rn01_00030490 predicted 306
8 SASI_Rn01_00030491 predicted 551
9 SASI_Rn01_00030492 predicted 452
10 SASI_Rn01_00030493 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347877 predicted 749
2 SASI_Rn02_00347878 predicted 576
3 SASI_Rn02_00347879 predicted 495
4 SASI_Rn02_00347880 predicted 511
5 SASI_Rn02_00347881 predicted 516
6 SASI_Rn02_00347882 predicted 592
7 SASI_Rn02_00347883 predicted 368
8 SASI_Rn02_00347884 predicted 402
9 SASI_Rn02_00347885 predicted 543
10 SASI_Rn02_00347886 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156460 predicted 345
2 SASI_Rn01_00156461 predicted 316
3 SASI_Rn01_00156462 predicted 274
4 SASI_Rn01_00156463 predicted 278
5 SASI_Rn01_00156464 predicted 325
6 SASI_Rn01_00156465 predicted 292
7 SASI_Rn01_00156466 predicted 371
8 SASI_Rn01_00156467 predicted 1957
9 SASI_Rn01_00156468 predicted 292
10 SASI_Rn01_00156469 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045384 predicted 484
2 SASI_Mm01_00045385 predicted 231
3 SASI_Mm01_00045386 predicted 241
4 SASI_Mm01_00045387 predicted 324
5 SASI_Mm01_00045388 predicted 365
6 SASI_Mm01_00045390 predicted 207
7 SASI_Mm01_00045391 predicted 203
8 SASI_Mm01_00045392 predicted 340
9 SASI_Mm01_00045393 predicted 226
10 SASI_Mm02_00327851 predicted 982
11 SASI_Mm01_00045389 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024469
VALIDATED
BHLHE41 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e41
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-208s21c1
Sequence:CCGGCAAGTTACCGCACAGATTAATCTCGAGATTAATCTGTGCGGTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-109s21c1
Sequence:CCGGGTTACTGGAACATAGGGATTTCTCGAGAAATCCCTATGTTCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-264s21c1
Sequence:CCGGTTGCTCAGCTGAAAGATTTACCTCGAGGTAAATCTTTCAGCTGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-234s21c1
Sequence:CCGGAGAAGAGACGAGACCGAATTACTCGAGTAATTCGGTCTCGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-332s21c1
Sequence:CCGGGTAGTCTTGGAATTAACTTTACTCGAGTAAAGTTAATTCCAAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024469.1-204s1c1
Sequence:CCGGCCTACAAGTTACCGCACAGATCTCGAGATCTGTGCGGTAACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-324s1c1
Sequence:CCGGAGAAAGCAGTAGTCTTGGAATCTCGAGATTCCAAGACTACTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-137s1c1
Sequence:CCGGCTGGACTATTCCTCTTTGTATCTCGAGATACAAAGAGGAATAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-271s1c1
Sequence:CCGGGCTGAAAGATTTACTGCCCGACTCGAGTCGGGCAGTAAATCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024469
VALIDATED
BHLHE41 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e41
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-208s21c1
Sequence:CCGGCAAGTTACCGCACAGATTAATCTCGAGATTAATCTGTGCGGTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-109s21c1
Sequence:CCGGGTTACTGGAACATAGGGATTTCTCGAGAAATCCCTATGTTCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-264s21c1
Sequence:CCGGTTGCTCAGCTGAAAGATTTACCTCGAGGTAAATCTTTCAGCTGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-234s21c1
Sequence:CCGGAGAAGAGACGAGACCGAATTACTCGAGTAATTCGGTCTCGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-332s21c1
Sequence:CCGGGTAGTCTTGGAATTAACTTTACTCGAGTAAAGTTAATTCCAAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024469.1-204s1c1
Sequence:CCGGCCTACAAGTTACCGCACAGATCTCGAGATCTGTGCGGTAACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-324s1c1
Sequence:CCGGAGAAAGCAGTAGTCTTGGAATCTCGAGATTCCAAGACTACTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-137s1c1
Sequence:CCGGCTGGACTATTCCTCTTTGTATCTCGAGATACAAAGAGGAATAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-271s1c1
Sequence:CCGGGCTGAAAGATTTACTGCCCGACTCGAGTCGGGCAGTAAATCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024469
VALIDATED
BHLHE41 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e41
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-208s21c1
Sequence:CCGGCAAGTTACCGCACAGATTAATCTCGAGATTAATCTGTGCGGTAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-109s21c1
Sequence:CCGGGTTACTGGAACATAGGGATTTCTCGAGAAATCCCTATGTTCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-264s21c1
Sequence:CCGGTTGCTCAGCTGAAAGATTTACCTCGAGGTAAATCTTTCAGCTGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-234s21c1
Sequence:CCGGAGAAGAGACGAGACCGAATTACTCGAGTAATTCGGTCTCGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024469.1-332s21c1
Sequence:CCGGGTAGTCTTGGAATTAACTTTACTCGAGTAAAGTTAATTCCAAGACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024469.1-204s1c1
Sequence:CCGGCCTACAAGTTACCGCACAGATCTCGAGATCTGTGCGGTAACTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-324s1c1
Sequence:CCGGAGAAAGCAGTAGTCTTGGAATCTCGAGATTCCAAGACTACTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-137s1c1
Sequence:CCGGCTGGACTATTCCTCTTTGTATCTCGAGATACAAAGAGGAATAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024469.1-271s1c1
Sequence:CCGGGCTGAAAGATTTACTGCCCGACTCGAGTCGGGCAGTAAATCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030762
VALIDATED
BHLHE41 MISSION shRNA Bacterial Glycerol Stock
basic helix-loop-helix family, member e41
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-677s21c1
Sequence:CCGGATGCGTTCCACTCGGGATTTCCTCGAGGAAATCCCGAGTGGAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-546s21c1
Sequence:CCGGAGCTGTAGTCTTGGAATTAACCTCGAGGTTAATTCCAAGACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030762.2-1861s21c1
Sequence:CCGGAGATGCACGACAGGCATAAACCTCGAGGTTTATGCCTGTCGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-609s21c1
Sequence:CCGGGCATCAGAAGATAATTGCTTTCTCGAGAAAGCAATTATCTTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030762.1-265s1c1
Sequence:CCGGCCTACAAATTACCGCACAGATCTCGAGATCTGTGCGGTAATTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-163s1c1
Sequence:CCGGAGAGACAGTTACTGGAACATACTCGAGTATGTTCCAGTAACTGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-332s1c1
Sequence:CCGGGCTGAAAGATTTACTGCCTGACTCGAGTCAGGCAGTAAATCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-452s1c1
Sequence:CCGGGCATCAGAAGATAATTGCTTTCTCGAGAAAGCAATTATCTTCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030762.1-486s1c1
Sequence:CCGGCGATCTCTGAAATCGCCCATTCTCGAGAATGGGCGATTTCAGAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030762
VALIDATED
BHLHE41 MISSION shRNA shRNA Plasmid DNA
basic helix-loop-helix family, member e41
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-677s21c1
Sequence:CCGGATGCGTTCCACTCGGGATTTCCTCGAGGAAATCCCGAGTGGAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-546s21c1
Sequence:CCGGAGCTGTAGTCTTGGAATTAACCTCGAGGTTAATTCCAAGACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030762.2-1861s21c1
Sequence:CCGGAGATGCACGACAGGCATAAACCTCGAGGTTTATGCCTGTCGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-609s21c1
Sequence:CCGGGCATCAGAAGATAATTGCTTTCTCGAGAAAGCAATTATCTTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030762.1-265s1c1
Sequence:CCGGCCTACAAATTACCGCACAGATCTCGAGATCTGTGCGGTAATTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-163s1c1
Sequence:CCGGAGAGACAGTTACTGGAACATACTCGAGTATGTTCCAGTAACTGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-332s1c1
Sequence:CCGGGCTGAAAGATTTACTGCCTGACTCGAGTCAGGCAGTAAATCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-452s1c1
Sequence:CCGGGCATCAGAAGATAATTGCTTTCTCGAGAAAGCAATTATCTTCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030762.1-486s1c1
Sequence:CCGGCGATCTCTGAAATCGCCCATTCTCGAGAATGGGCGATTTCAGAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030762
VALIDATED
BHLHE41 MISSION shRNA Lentiviral Transduction Particles
basic helix-loop-helix family, member e41
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-677s21c1
Sequence:CCGGATGCGTTCCACTCGGGATTTCCTCGAGGAAATCCCGAGTGGAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-546s21c1
Sequence:CCGGAGCTGTAGTCTTGGAATTAACCTCGAGGTTAATTCCAAGACTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030762.2-1861s21c1
Sequence:CCGGAGATGCACGACAGGCATAAACCTCGAGGTTTATGCCTGTCGTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030762.2-609s21c1
Sequence:CCGGGCATCAGAAGATAATTGCTTTCTCGAGAAAGCAATTATCTTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030762.1-265s1c1
Sequence:CCGGCCTACAAATTACCGCACAGATCTCGAGATCTGTGCGGTAATTTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-163s1c1
Sequence:CCGGAGAGACAGTTACTGGAACATACTCGAGTATGTTCCAGTAACTGTCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-332s1c1
Sequence:CCGGGCTGAAAGATTTACTGCCTGACTCGAGTCAGGCAGTAAATCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030762.1-452s1c1
Sequence:CCGGGCATCAGAAGATAATTGCTTTCTCGAGAAAGCAATTATCTTCTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030762.1-486s1c1
Sequence:CCGGCGATCTCTGAAATCGCCCATTCTCGAGAATGGGCGATTTCAGAGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks