EMAIL THIS PAGE TO A FRIEND

BHMT2

betaine--homocysteine S-methyltransferase 2

83 Gene Product Result for
UniProtKB ID: Q9H2M3, B7Z516, Q9NXX7
Gene ID:
Human(23743) Summary: Homocysteine is a sulfur-containing amino acid that plays a crucial role in methylation reactions. Transfer of the methyl group from betaine to homocysteine creates methionine, which donates the methyl group to methylate DNA, proteins, lipids, and other intracellular metabolites. The protein encoded by this gene is one of two methyl transferases that can catalyze the transfer of the methyl group from betaine to homocysteine. Anomalies in homocysteine metabolism have been implicated in disorders ranging from vascular disease to neural tube birth defects such as spina bifida. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(64918) betaine-homocysteine methyltransferase 2
Rat(365972) betaine-homocysteine S-methyltransferase 2
naked mole-rat(101720782) betaine--homocysteine S-methyltransferase 2
domestic guinea pig(100718920) betaine--homocysteine S-methyltransferase 2
sheep(101108575) betaine--homocysteine S-methyltransferase 2
Horse(100073266) betaine--homocysteine S-methyltransferase 2
dog(488934) betaine--homocysteine S-methyltransferase 2
cow(616683) betaine--homocysteine S-methyltransferase 2
domestic cat(101084933) betaine--homocysteine S-methyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022884 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022884 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022884 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017614 Rosetta Predictions human pricing
NM_001014256 Rosetta Predictions rat pricing
NM_022884 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237630 predicted 1044
2 SASI_Hs01_00237631 predicted 711
3 SASI_Hs01_00237632 predicted 382
4 SASI_Hs01_00237633 predicted 358
5 SASI_Hs01_00237634 predicted 519
6 SASI_Hs01_00237635 predicted 783
7 SASI_Hs01_00237636 predicted 217
8 SASI_Hs01_00237637 predicted 532
9 SASI_Hs01_00237638 predicted 351
10 SASI_Hs02_00350285 predicted 274
11 SASI_Hs01_00237629 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117882 predicted 1041
2 SASI_Rn01_00117883 predicted 1327
3 SASI_Rn02_00201823 predicted 1277
4 SASI_Rn01_00117884 predicted 672
5 SASI_Rn02_00201824 predicted 768
6 SASI_Rn01_00117885 predicted 1335
7 SASI_Rn01_00117888 predicted 1088
8 SASI_Rn02_00201825 predicted 769
9 SASI_Rn02_00201826 predicted 1075
10 SASI_Rn01_00117890 predicted 1240
11 SASI_Rn01_00117886 predicted 1050
12 SASI_Rn01_00117887 predicted 389
13 SASI_Rn01_00117889 predicted 390
14 SASI_Rn01_00117891 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160249 predicted 1124
2 SASI_Mm01_00160250 predicted 393
3 SASI_Mm01_00160251 predicted 503
4 SASI_Mm02_00326676 predicted 396
5 SASI_Mm01_00160252 predicted 795
6 SASI_Mm02_00326677 predicted 193
7 SASI_Mm01_00160253 predicted 377
8 SASI_Mm02_00326678 predicted 378
9 SASI_Mm01_00160255 predicted 1061
10 SASI_Mm01_00160257 predicted 690
11 SASI_Mm01_00160248 predicted 1406
12 SASI_Mm01_00160254 predicted 1230
13 SASI_Mm01_00160256 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017614
BHMT2 MISSION shRNA Bacterial Glycerol Stock
betaine--homocysteine S-methyltransferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017614.3-1507s1c1
Sequence:CCGGGCTAGATACTTGAGGATGATACTCGAGTATCATCCTCAAGTATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-215s1c1
Sequence:CCGGGAGAGCAGGATCAAATGTCATCTCGAGATGACATTTGATCCTGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-1094s1c1
Sequence:CCGGGCTGTCAAAGCCAGACTTCTACTCGAGTAGAAGTCTGGCTTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-1038s1c1
Sequence:CCGGCGAAGGGAGTATTGGGAGAATCTCGAGATTCTCCCAATACTCCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-364s1c1
Sequence:CCGGGCCAGACATCAATATACAAATCTCGAGATTTGTATATTGATGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017614
BHMT2 MISSION shRNA shRNA Plasmid DNA
betaine--homocysteine S-methyltransferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017614.3-1507s1c1
Sequence:CCGGGCTAGATACTTGAGGATGATACTCGAGTATCATCCTCAAGTATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-215s1c1
Sequence:CCGGGAGAGCAGGATCAAATGTCATCTCGAGATGACATTTGATCCTGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-1094s1c1
Sequence:CCGGGCTGTCAAAGCCAGACTTCTACTCGAGTAGAAGTCTGGCTTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-1038s1c1
Sequence:CCGGCGAAGGGAGTATTGGGAGAATCTCGAGATTCTCCCAATACTCCCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-364s1c1
Sequence:CCGGGCCAGACATCAATATACAAATCTCGAGATTTGTATATTGATGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017614
BHMT2 MISSION shRNA Lentiviral Transduction Particles
betaine--homocysteine S-methyltransferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017614.3-1507s1c1
Sequence:CCGGGCTAGATACTTGAGGATGATACTCGAGTATCATCCTCAAGTATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-215s1c1
Sequence:CCGGGAGAGCAGGATCAAATGTCATCTCGAGATGACATTTGATCCTGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-1094s1c1
Sequence:CCGGGCTGTCAAAGCCAGACTTCTACTCGAGTAGAAGTCTGGCTTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-1038s1c1
Sequence:CCGGCGAAGGGAGTATTGGGAGAATCTCGAGATTCTCCCAATACTCCCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017614.3-364s1c1
Sequence:CCGGGCCAGACATCAATATACAAATCTCGAGATTTGTATATTGATGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022884
BHMT2 MISSION shRNA Bacterial Glycerol Stock
betaine--homocysteine S-methyltransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022884.1-1114s1c1
Sequence:CCGGGCAATGAAAGAGAACTCTGAACTCGAGTTCAGAGTTCTCTTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-357s1c1
Sequence:CCGGCTGCCAGACATCACTCTACAACTCGAGTTGTAGAGTGATGTCTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-1088s1c1
Sequence:CCGGCCCTATCAAAGCCAGATGCATCTCGAGATGCATCTGGCTTTGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-1033s1c1
Sequence:CCGGAGACGAGAATACTGGGAGAATCTCGAGATTCTCCCAGTATTCTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-175s1c1
Sequence:CCGGCCAAGTGCAGTTCGTCAACTTCTCGAGAAGTTGACGAACTGCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022884
BHMT2 MISSION shRNA shRNA Plasmid DNA
betaine--homocysteine S-methyltransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022884.1-1114s1c1
Sequence:CCGGGCAATGAAAGAGAACTCTGAACTCGAGTTCAGAGTTCTCTTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-357s1c1
Sequence:CCGGCTGCCAGACATCACTCTACAACTCGAGTTGTAGAGTGATGTCTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-1088s1c1
Sequence:CCGGCCCTATCAAAGCCAGATGCATCTCGAGATGCATCTGGCTTTGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-1033s1c1
Sequence:CCGGAGACGAGAATACTGGGAGAATCTCGAGATTCTCCCAGTATTCTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-175s1c1
Sequence:CCGGCCAAGTGCAGTTCGTCAACTTCTCGAGAAGTTGACGAACTGCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022884
BHMT2 MISSION shRNA Lentiviral Transduction Particles
betaine--homocysteine S-methyltransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022884.1-1114s1c1
Sequence:CCGGGCAATGAAAGAGAACTCTGAACTCGAGTTCAGAGTTCTCTTTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-357s1c1
Sequence:CCGGCTGCCAGACATCACTCTACAACTCGAGTTGTAGAGTGATGTCTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-1088s1c1
Sequence:CCGGCCCTATCAAAGCCAGATGCATCTCGAGATGCATCTGGCTTTGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-1033s1c1
Sequence:CCGGAGACGAGAATACTGGGAGAATCTCGAGATTCTCCCAGTATTCTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022884.1-175s1c1
Sequence:CCGGCCAAGTGCAGTTCGTCAACTTCTCGAGAAGTTGACGAACTGCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)