EMAIL THIS PAGE TO A FRIEND

BHMT

betaine--homocysteine S-methyltransferase

62 Gene Product Result for
Synonyms: BHMT1
UniProtKB ID: Q93088, Q9UNI9
Gene ID:
Human(635) Summary: This gene encodes a cytosolic enzyme that catalyzes the conversion of betaine and homocysteine to dimethylglycine and methionine, respectively. Defects in this gene could lead to hyperhomocyst(e)inemia, but such a defect has not yet been observed. [provided by RefSeq, Jul 2008]
Mouse(12116) betaine-homocysteine methyltransferase
Rat(81508) betaine-homocysteine S-methyltransferase
sheep(101113853) betaine--homocysteine S-methyltransferase
naked mole-rat(101723121) betaine--homocysteine S-methyltransferase
domestic guinea pig(100724631) betaine--homocysteine S-methyltransferase
Zebrafish(322228) betaine-homocysteine methyltransferase
domestic cat(101085179) betaine--homocysteine S-methyltransferase
cow(497025) betaine--homocysteine S-methyltransferase
chicken(416371) betaine--homocysteine S-methyltransferase
dog(479171) betaine--homocysteine S-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
B0563 Anti-BHMT (76-90) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV41474 Anti-BHMT (AB1) antibody produced in rabbit IgG fraction of antiserum bovine, rabbit, human, pig, guinea pig, horse, rat, mouse, zebrafish, canine
immunohistochemistry, western blot pricing
AV41475 Anti-BHMT (AB2) antibody produced in rabbit IgG fraction of antiserum horse, mouse, rat, bovine, guinea pig, canine, rabbit, human
immunohistochemistry, western blot pricing
SAB2500158 Anti-BHMT antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1405516 Anti-BHMT antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2701765 Anti-bhmt antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA058310 Anti-BHMT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA038285 Anti-BHMT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5300140 Monoclonal Anti-BHMT antibody produced in mouse clone 8C11H5, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3633 Cystathionine ≥90% (HPLC) human pricing
H0501 DL-Homocystine human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001713 Rosetta Predictions human pricing
NM_030850 Rosetta Predictions rat pricing
NM_016668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060344 predicted 1276
2 SASI_Hs01_00060345 predicted 1150
3 SASI_Hs01_00060346 predicted 529
4 SASI_Hs01_00060347 predicted 876
5 SASI_Hs01_00060348 predicted 476
6 SASI_Hs01_00060349 predicted 436
7 SASI_Hs02_00332405 predicted 816
8 SASI_Hs01_00060351 predicted 1406
9 SASI_Hs01_00060352 predicted 1155
10 SASI_Hs01_00060353 predicted 629
11 SASI_Hs01_00060350 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096886 predicted 1392
2 SASI_Rn01_00096887 predicted 1500
3 SASI_Rn01_00096888 predicted 442
4 SASI_Rn01_00096889 predicted 1582
5 SASI_Rn01_00096892 predicted 1435
6 SASI_Rn01_00096893 predicted 607
7 SASI_Rn01_00096894 predicted 1475
8 SASI_Rn01_00096895 predicted 1398
9 SASI_Rn02_00264092 predicted 1480
10 SASI_Rn02_00264093 predicted 1530
11 SASI_Rn01_00096890 predicted 1487
12 SASI_Rn01_00096891 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026937 predicted 1312
2 SASI_Mm01_00026938 predicted 477
3 SASI_Mm02_00323287 predicted 525
4 SASI_Mm01_00026940 predicted 1521
5 SASI_Mm01_00026941 predicted 339
6 SASI_Mm01_00026942 predicted 671
7 SASI_Mm01_00026944 predicted 1261
8 SASI_Mm01_00026945 predicted 295
9 SASI_Mm02_00323288 predicted 303
10 SASI_Mm02_00323289 predicted 478
11 SASI_Mm01_00026939 predicted 322
12 SASI_Mm01_00026943 predicted 522
13 SASI_Mm01_00026946 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016668
BHMT MISSION shRNA Bacterial Glycerol Stock
betaine--homocysteine S-methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016668.2-1534s1c1
Sequence:CCGGGCCGTGTAACAAACAGTCATACTCGAGTATGACTGTTTGTTACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-271s1c1
Sequence:CCGGCGTCATGCAGACCTTCACTTTCTCGAGAAAGTGAAGGTCTGCATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-1105s1c1
Sequence:CCGGCAGAAAGGAATACTGGCAGAACTCGAGTTCTGCCAGTATTCCTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-843s1c1
Sequence:CCGGGATTTATTGATCTCCCAGAATCTCGAGATTCTGGGAGATCAATAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-110s1c1
Sequence:CCGGCGCTTAAATGCCGGAGAAGTTCTCGAGAACTTCTCCGGCATTTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016668
BHMT MISSION shRNA shRNA Plasmid DNA
betaine--homocysteine S-methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016668.2-1534s1c1
Sequence:CCGGGCCGTGTAACAAACAGTCATACTCGAGTATGACTGTTTGTTACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-271s1c1
Sequence:CCGGCGTCATGCAGACCTTCACTTTCTCGAGAAAGTGAAGGTCTGCATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-1105s1c1
Sequence:CCGGCAGAAAGGAATACTGGCAGAACTCGAGTTCTGCCAGTATTCCTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-843s1c1
Sequence:CCGGGATTTATTGATCTCCCAGAATCTCGAGATTCTGGGAGATCAATAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-110s1c1
Sequence:CCGGCGCTTAAATGCCGGAGAAGTTCTCGAGAACTTCTCCGGCATTTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016668
BHMT MISSION shRNA Lentiviral Transduction Particles
betaine--homocysteine S-methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097579    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016668.2-1534s1c1
Sequence:CCGGGCCGTGTAACAAACAGTCATACTCGAGTATGACTGTTTGTTACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-271s1c1
Sequence:CCGGCGTCATGCAGACCTTCACTTTCTCGAGAAAGTGAAGGTCTGCATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-1105s1c1
Sequence:CCGGCAGAAAGGAATACTGGCAGAACTCGAGTTCTGCCAGTATTCCTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-843s1c1
Sequence:CCGGGATTTATTGATCTCCCAGAATCTCGAGATTCTGGGAGATCAATAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016668.2-110s1c1
Sequence:CCGGCGCTTAAATGCCGGAGAAGTTCTCGAGAACTTCTCCGGCATTTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001713
BHMT MISSION shRNA Bacterial Glycerol Stock
betaine--homocysteine S-methyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-452s1c1
Sequence:CCGGGCAACAGTTAGAGGTCTTTATCTCGAGATAAAGACCTCTAACTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-1203s1c1
Sequence:CCGGCAGCTGAAAGAGCTCTTTGAACTCGAGTTCAAAGAGCTCTTTCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-110s1c1
Sequence:CCGGGTTTGTCTTTGCACTGGAGAACTCGAGTTCTCCAGTGCAAAGACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-287s1c1
Sequence:CCGGCAACTATGTCTTAGAGAAGATCTCGAGATCTTCTCTAAGACATAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-662s1c1
Sequence:CCGGCATTGGTGTGAACTGCCACTTCTCGAGAAGTGGCAGTTCACACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001713.2-138s21c1
Sequence:CCGGGGGCATCCTAGAACGTTTAAACTCGAGTTTAAACGTTCTAGGATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001713.2-1346s21c1
Sequence:CCGGTGATGAATTTCTAGGTGTTTGCTCGAGCAAACACCTAGAAATTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001713.2-1538s21c1
Sequence:CCGGATCTTGAACAGGTTCACTAAGCTCGAGCTTAGTGAACCTGTTCAAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001713.2-622s21c1
Sequence:CCGGACCTTGATAGCATCCGGTAAACTCGAGTTTACCGGATGCTATCAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001713
BHMT MISSION shRNA shRNA Plasmid DNA
betaine--homocysteine S-methyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-452s1c1
Sequence:CCGGGCAACAGTTAGAGGTCTTTATCTCGAGATAAAGACCTCTAACTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-1203s1c1
Sequence:CCGGCAGCTGAAAGAGCTCTTTGAACTCGAGTTCAAAGAGCTCTTTCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-110s1c1
Sequence:CCGGGTTTGTCTTTGCACTGGAGAACTCGAGTTCTCCAGTGCAAAGACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-287s1c1
Sequence:CCGGCAACTATGTCTTAGAGAAGATCTCGAGATCTTCTCTAAGACATAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-662s1c1
Sequence:CCGGCATTGGTGTGAACTGCCACTTCTCGAGAAGTGGCAGTTCACACCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001713.2-138s21c1
Sequence:CCGGGGGCATCCTAGAACGTTTAAACTCGAGTTTAAACGTTCTAGGATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001713.2-1346s21c1
Sequence:CCGGTGATGAATTTCTAGGTGTTTGCTCGAGCAAACACCTAGAAATTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001713.2-1538s21c1
Sequence:CCGGATCTTGAACAGGTTCACTAAGCTCGAGCTTAGTGAACCTGTTCAAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001713.2-622s21c1
Sequence:CCGGACCTTGATAGCATCCGGTAAACTCGAGTTTACCGGATGCTATCAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001713
BHMT MISSION shRNA Lentiviral Transduction Particles
betaine--homocysteine S-methyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-452s1c1
Sequence:CCGGGCAACAGTTAGAGGTCTTTATCTCGAGATAAAGACCTCTAACTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-1203s1c1
Sequence:CCGGCAGCTGAAAGAGCTCTTTGAACTCGAGTTCAAAGAGCTCTTTCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-110s1c1
Sequence:CCGGGTTTGTCTTTGCACTGGAGAACTCGAGTTCTCCAGTGCAAAGACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-287s1c1
Sequence:CCGGCAACTATGTCTTAGAGAAGATCTCGAGATCTTCTCTAAGACATAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001713.1-662s1c1
Sequence:CCGGCATTGGTGTGAACTGCCACTTCTCGAGAAGTGGCAGTTCACACCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001713.2-138s21c1
Sequence:CCGGGGGCATCCTAGAACGTTTAAACTCGAGTTTAAACGTTCTAGGATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001713.2-1346s21c1
Sequence:CCGGTGATGAATTTCTAGGTGTTTGCTCGAGCAAACACCTAGAAATTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001713.2-1538s21c1
Sequence:CCGGATCTTGAACAGGTTCACTAAGCTCGAGCTTAGTGAACCTGTTCAAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001713.2-622s21c1
Sequence:CCGGACCTTGATAGCATCCGGTAAACTCGAGTTTACCGGATGCTATCAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)