EMAIL THIS PAGE TO A FRIEND

BICC1

bicaudal C homolog 1 (Drosophila)

72 Gene Product Result for
Synonyms: BICC CYSRD
UniProtKB ID: Q9H694
Gene ID:
Human(80114) Summary: This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
Mouse(83675) bicaudal C homolog 1 (Drosophila)
Rat(361832) bicaudal C homolog 1 (Drosophila)
chicken(423604) bicaudal C homolog 1 (Drosophila)
cow(537799) bicaudal C homolog 1 (Drosophila)
dog(608626) bicaudal C homolog 1 (Drosophila)
Horse(100072191) bicaudal C homolog 1 (Drosophila)
domestic cat(101099836) bicaudal C homolog 1 (Drosophila)
naked mole-rat(101726690) bicaudal C homolog 1 (Drosophila)
domestic guinea pig(100727510) bicaudal C homolog 1 (Drosophila)
sheep(101119363) bicaudal C homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080512 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080512 Rosetta Predictions human pricing
XM_498431 Rosetta Predictions human pricing
NM_001108531 Rosetta Predictions rat pricing
NM_031397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315557 predicted 732
2 SASI_Hs02_00315558 predicted 1227
3 SASI_Hs02_00315559 predicted 1672
4 SASI_Hs02_00315560 predicted 1084
5 SASI_Hs02_00315561 predicted 572
6 SASI_Hs02_00315562 predicted 2828
7 SASI_Hs02_00315563 predicted 1096
8 SASI_Hs02_00315564 predicted 2007
9 SASI_Hs02_00315565 predicted 1166
10 SASI_Hs02_00315566 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_498431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257517 predicted 854
2 SASI_Hs01_00257518 predicted 1339
3 SASI_Hs01_00257519 predicted 1785
4 SASI_Hs01_00257520 predicted 1206
5 SASI_Hs01_00257521 predicted 686
6 SASI_Hs01_00257522 predicted 2662
7 SASI_Hs01_00257523 predicted 2114
8 SASI_Hs01_00257524 predicted 1282
9 SASI_Hs01_00257525 predicted 1642
10 SASI_Hs01_00257526 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239559 predicted 2452
2 SASI_Rn02_00239560 predicted 2055
3 SASI_Rn02_00239561 predicted 663
4 SASI_Rn02_00239562 predicted 1007
5 SASI_Rn02_00239563 predicted 2332
6 SASI_Rn02_00239564 predicted 418
7 SASI_Rn02_00239565 predicted 1592
8 SASI_Rn02_00239566 predicted 1672
9 SASI_Rn02_00239567 predicted 2172
10 SASI_Rn02_00239568 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112930 predicted 700
2 SASI_Mm01_00112931 predicted 2272
3 SASI_Mm02_00337147 predicted 1219
4 SASI_Mm01_00112933 predicted 2541
5 SASI_Mm01_00112934 predicted 1878
6 SASI_Mm01_00112935 predicted 713
7 SASI_Mm01_00112936 predicted 2227
8 SASI_Mm01_00112937 predicted 1658
9 SASI_Mm01_00112938 predicted 2048
10 SASI_Mm02_00337148 predicted 557
11 SASI_Mm01_00112932 predicted 2076
12 SASI_Mm01_00112939 predicted 1587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031397
VALIDATED
BICC1 MISSION shRNA Bacterial Glycerol Stock
bicaudal C homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-2909s1c1
Sequence:CCGGCGCCAGTATCATTCAGACATTCTCGAGAATGTCTGAATGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-419s1c1
Sequence:CCGGCGCGTCACATTGAAGATGGATCTCGAGATCCATCTTCAATGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1594s1c1
Sequence:CCGGCCAGGCCACATTAACCAATATCTCGAGATATTGGTTAATGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1747s1c1
Sequence:CCGGGCAGCCTGCAAACATGAAATACTCGAGTATTTCATGTTTGCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1593s1c1
Sequence:CCGGCCCAGGCCACATTAACCAATACTCGAGTATTGGTTAATGTGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-1593s21c1
Sequence:CCGGCCAGGCCACATTAACCAATATCTCGAGATATTGGTTAATGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-2908s21c1
Sequence:CCGGCGCCAGTATCATTCAGACATTCTCGAGAATGTCTGAATGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-1746s21c1
Sequence:CCGGGCAGCCTGCAAACATGAAATACTCGAGTATTTCATGTTTGCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-418s21c1
Sequence:CCGGCGCGTCACATTGAAGATGGATCTCGAGATCCATCTTCAATGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031397
VALIDATED
BICC1 MISSION shRNA shRNA Plasmid DNA
bicaudal C homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-2909s1c1
Sequence:CCGGCGCCAGTATCATTCAGACATTCTCGAGAATGTCTGAATGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-419s1c1
Sequence:CCGGCGCGTCACATTGAAGATGGATCTCGAGATCCATCTTCAATGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1594s1c1
Sequence:CCGGCCAGGCCACATTAACCAATATCTCGAGATATTGGTTAATGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1747s1c1
Sequence:CCGGGCAGCCTGCAAACATGAAATACTCGAGTATTTCATGTTTGCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1593s1c1
Sequence:CCGGCCCAGGCCACATTAACCAATACTCGAGTATTGGTTAATGTGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-1593s21c1
Sequence:CCGGCCAGGCCACATTAACCAATATCTCGAGATATTGGTTAATGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-2908s21c1
Sequence:CCGGCGCCAGTATCATTCAGACATTCTCGAGAATGTCTGAATGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-1746s21c1
Sequence:CCGGGCAGCCTGCAAACATGAAATACTCGAGTATTTCATGTTTGCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-418s21c1
Sequence:CCGGCGCGTCACATTGAAGATGGATCTCGAGATCCATCTTCAATGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031397
VALIDATED
BICC1 MISSION shRNA Lentiviral Transduction Particles
bicaudal C homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-2909s1c1
Sequence:CCGGCGCCAGTATCATTCAGACATTCTCGAGAATGTCTGAATGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-419s1c1
Sequence:CCGGCGCGTCACATTGAAGATGGATCTCGAGATCCATCTTCAATGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1594s1c1
Sequence:CCGGCCAGGCCACATTAACCAATATCTCGAGATATTGGTTAATGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1747s1c1
Sequence:CCGGGCAGCCTGCAAACATGAAATACTCGAGTATTTCATGTTTGCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031397.1-1593s1c1
Sequence:CCGGCCCAGGCCACATTAACCAATACTCGAGTATTGGTTAATGTGGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-1593s21c1
Sequence:CCGGCCAGGCCACATTAACCAATATCTCGAGATATTGGTTAATGTGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-2908s21c1
Sequence:CCGGCGCCAGTATCATTCAGACATTCTCGAGAATGTCTGAATGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-1746s21c1
Sequence:CCGGGCAGCCTGCAAACATGAAATACTCGAGTATTTCATGTTTGCAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031397.2-418s21c1
Sequence:CCGGCGCGTCACATTGAAGATGGATCTCGAGATCCATCTTCAATGTGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025044
BICC1 MISSION shRNA Bacterial Glycerol Stock
bicaudal C homolog 1 (Drosophila)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-1255s1c1
Sequence:CCGGCCCACAATGACAACCACTTATCTCGAGATAAGTGGTTGTCATTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-656s1c1
Sequence:CCGGCCACTTCATCACTTGGAGAAACTCGAGTTTCTCCAAGTGATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-751s1c1
Sequence:CCGGCCCACTGAAGGTTGTAATGATCTCGAGATCATTACAACCTTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-445s1c1
Sequence:CCGGCCACACCTTATGATTCCATCTCTCGAGAGATGGAATCATAAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025044
BICC1 MISSION shRNA shRNA Plasmid DNA
bicaudal C homolog 1 (Drosophila)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-1255s1c1
Sequence:CCGGCCCACAATGACAACCACTTATCTCGAGATAAGTGGTTGTCATTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-656s1c1
Sequence:CCGGCCACTTCATCACTTGGAGAAACTCGAGTTTCTCCAAGTGATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-751s1c1
Sequence:CCGGCCCACTGAAGGTTGTAATGATCTCGAGATCATTACAACCTTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-445s1c1
Sequence:CCGGCCACACCTTATGATTCCATCTCTCGAGAGATGGAATCATAAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025044
BICC1 MISSION shRNA Lentiviral Transduction Particles
bicaudal C homolog 1 (Drosophila)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-1255s1c1
Sequence:CCGGCCCACAATGACAACCACTTATCTCGAGATAAGTGGTTGTCATTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-656s1c1
Sequence:CCGGCCACTTCATCACTTGGAGAAACTCGAGTTTCTCCAAGTGATGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-751s1c1
Sequence:CCGGCCCACTGAAGGTTGTAATGATCTCGAGATCATTACAACCTTCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025044.2-445s1c1
Sequence:CCGGCCACACCTTATGATTCCATCTCTCGAGAGATGGAATCATAAGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080512
VALIDATED
BICC1 MISSION shRNA Bacterial Glycerol Stock
bicaudal C homolog 1 (Drosophila)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000353662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080512.1-1543s21c1
Sequence:CCGGCCACACCTTATGATTCCATCTCTCGAGAGATGGAATCATAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-1754s21c1
Sequence:CCGGCCACTTCATCACTTGGAGAAACTCGAGTTTCTCCAAGTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-2944s21c1
Sequence:CCGGTGCCCGCTGACTAACTGTAAACTCGAGTTTACAGTTAGTCAGCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-2353s21c1
Sequence:CCGGCCCACAATGACAACCACTTATCTCGAGATAAGTGGTTGTCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080512
VALIDATED
BICC1 MISSION shRNA shRNA Plasmid DNA
bicaudal C homolog 1 (Drosophila)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000353662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080512.1-1543s21c1
Sequence:CCGGCCACACCTTATGATTCCATCTCTCGAGAGATGGAATCATAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-1754s21c1
Sequence:CCGGCCACTTCATCACTTGGAGAAACTCGAGTTTCTCCAAGTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-2944s21c1
Sequence:CCGGTGCCCGCTGACTAACTGTAAACTCGAGTTTACAGTTAGTCAGCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-2353s21c1
Sequence:CCGGCCCACAATGACAACCACTTATCTCGAGATAAGTGGTTGTCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080512
VALIDATED
BICC1 MISSION shRNA Lentiviral Transduction Particles
bicaudal C homolog 1 (Drosophila)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000353662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080512.1-1543s21c1
Sequence:CCGGCCACACCTTATGATTCCATCTCTCGAGAGATGGAATCATAAGGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-1754s21c1
Sequence:CCGGCCACTTCATCACTTGGAGAAACTCGAGTTTCTCCAAGTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330424    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-2944s21c1
Sequence:CCGGTGCCCGCTGACTAACTGTAAACTCGAGTTTACAGTTAGTCAGCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080512.1-2353s21c1
Sequence:CCGGCCCACAATGACAACCACTTATCTCGAGATAAGTGGTTGTCATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks