EMAIL THIS PAGE TO A FRIEND

BICD1

bicaudal D homolog 1 (Drosophila)

120 Gene Product Result for
Synonyms: BICD
UniProtKB ID: Q96G01, A8K2C3, F8W113, O43892, O43893
Gene ID:
Human(636) Summary: This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(12121) bicaudal D homolog 1 (Drosophila)
Rat(362466) bicaudal D homolog 1 (Drosophila)
chicken(427919) bicaudal D homolog 1 (Drosophila)
dog(610028) bicaudal D homolog 1 (Drosophila)
Horse(100064897) bicaudal D homolog 1 (Drosophila)
cow(533796) bicaudal D homolog 1 (Drosophila)
domestic cat(101090026) bicaudal D homolog 1 (Drosophila)
sheep(101105646) bicaudal D homolog 1 (Drosophila)
domestic guinea pig(100733676) bicaudal D homolog 1 (Drosophila)
naked mole-rat(101713727) bicaudal D homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009753 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009753 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009753 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003398 Rosetta Predictions human pricing
NM_001714 Rosetta Predictions human pricing
NM_001108653 Rosetta Predictions rat pricing
NM_001112796 Rosetta Predictions mouse pricing
NM_009753 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182553 predicted 1344
2 SASI_Hs01_00182554 predicted 1952
3 SASI_Hs01_00182556 predicted 2148
4 SASI_Hs01_00182557 predicted 1735
5 SASI_Hs02_00304284 predicted 1839
6 SASI_Hs01_00182558 predicted 773
7 SASI_Hs01_00182559 predicted 1628
8 SASI_Hs01_00182561 predicted 528
9 SASI_Hs01_00182562 predicted 2013
10 SASI_Hs02_00304285 predicted 657
11 SASI_Hs01_00182555 predicted 915
12 SASI_Hs01_00182560 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083660 predicted 1346
2 SASI_Hs01_00083661 predicted 1951
3 SASI_Hs01_00083663 predicted 2148
4 SASI_Hs01_00083664 predicted 1731
5 SASI_Hs02_00332406 predicted 1836
6 SASI_Hs01_00083665 predicted 767
7 SASI_Hs01_00083666 predicted 1631
8 SASI_Hs01_00083668 predicted 523
9 SASI_Hs01_00083669 predicted 2011
10 SASI_Hs02_00332407 predicted 651
11 SASI_Hs01_00083662 predicted 908
12 SASI_Hs01_00083667 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240749 predicted 2040
2 SASI_Rn02_00240750 predicted 1067
3 SASI_Rn02_00240751 predicted 1933
4 SASI_Rn02_00240752 predicted 1645
5 SASI_Rn02_00240753 predicted 1792
6 SASI_Rn02_00240754 predicted 2664
7 SASI_Rn02_00240755 predicted 458
8 SASI_Rn02_00240756 predicted 638
9 SASI_Rn02_00240757 predicted 2294
10 SASI_Rn02_00240758 predicted 2740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307103 predicted 2157
2 SASI_Mm02_00307104 predicted 1902
3 SASI_Mm02_00307105 predicted 2053
4 SASI_Mm02_00307106 predicted 716
5 SASI_Mm02_00307107 predicted 2190
6 SASI_Mm02_00307108 predicted 1693
7 SASI_Mm02_00307109 predicted 2062
8 SASI_Mm02_00307110 predicted 756
9 SASI_Mm02_00307111 predicted 1891
10 SASI_Mm02_00307112 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009753 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200680 predicted 2151
2 SASI_Mm01_00200681 predicted 1901
3 SASI_Mm01_00200682 predicted 2051
4 SASI_Mm01_00200683 predicted 714
5 SASI_Mm01_00200684 predicted 2197
6 SASI_Mm01_00200687 predicted 1695
7 SASI_Mm01_00200688 predicted 2067
8 SASI_Mm01_00200689 predicted 754
9 SASI_Mm02_00316939 predicted 1895
10 SASI_Mm01_00200686 predicted 1134
11 SASI_Mm01_00200685 predicted 2610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001714
VALIDATED
BICD1 MISSION shRNA Bacterial Glycerol Stock
bicaudal D homolog 1 (Drosophila)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-680s21c1
Sequence:CCGGAGCATGAGATTAAGCGATTTGCTCGAGCAAATCGCTTAATCTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2703s21c1
Sequence:CCGGTTCCTACCTACAGAATTTATTCTCGAGAATAAATTCTGTAGGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001714.2-3349s21c1
Sequence:CCGGTATATTGCAGTATCATCTTTCCTCGAGGAAAGATGATACTGCAATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2248s21c1
Sequence:CCGGACCATGACGAAGCTTAGAAATCTCGAGATTTCTAAGCTTCGTCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-377s21c1
Sequence:CCGGCATCGAAGGAGGCTTACTATCCTCGAGGATAGTAAGCCTCCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2198s21c1
Sequence:CCGGTAGCTAATCTCAAGAACAAATCTCGAGATTTGTTCTTGAGATTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001714.2-3302s1c1
Sequence:CCGGGGCTTTACCTCGATAGCATAACTCGAGTTATGCTATCGAGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001714.2-3097s1c1
Sequence:CCGGTCGGTTGTTAGATGTACAATTCTCGAGAATTGTACATCTAACAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-1793s1c1
Sequence:CCGGCGGTAGAAACAAGGACCTCATCTCGAGATGAGGTCCTTGTTTCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-2412s1c1
Sequence:CCGGCACTTTGTTACGAATGGCTATCTCGAGATAGCCATTCGTAACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-543s1c1
Sequence:CCGGGAAGGATGAAATCCGAGAATACTCGAGTATTCTCGGATTTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-2071s1c1
Sequence:CCGGGATAAAGACAAGGAAGCCTTACTCGAGTAAGGCTTCCTTGTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-658s1c1
Sequence:CCGGCAGGTTGAATACGAAGGCTTACTCGAGTAAGCCTTCGTATTCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-1434s1c1
Sequence:CCGGGAAGGCCAAGTATGAGAGTAACTCGAGTTACTCTCATACTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-904s1c1
Sequence:CCGGGATGGGAGTGAACCAAACAATCTCGAGATTGTTTGGTTCACTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001714.1-739s1c1
Sequence:CCGGGCCATCCGATTGAAAGAGATTCTCGAGAATCTCTTTCAATCGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001714
VALIDATED
BICD1 MISSION shRNA shRNA Plasmid DNA
bicaudal D homolog 1 (Drosophila)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-680s21c1
Sequence:CCGGAGCATGAGATTAAGCGATTTGCTCGAGCAAATCGCTTAATCTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2703s21c1
Sequence:CCGGTTCCTACCTACAGAATTTATTCTCGAGAATAAATTCTGTAGGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001714.2-3349s21c1
Sequence:CCGGTATATTGCAGTATCATCTTTCCTCGAGGAAAGATGATACTGCAATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2248s21c1
Sequence:CCGGACCATGACGAAGCTTAGAAATCTCGAGATTTCTAAGCTTCGTCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-377s21c1
Sequence:CCGGCATCGAAGGAGGCTTACTATCCTCGAGGATAGTAAGCCTCCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2198s21c1
Sequence:CCGGTAGCTAATCTCAAGAACAAATCTCGAGATTTGTTCTTGAGATTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001714.2-3302s1c1
Sequence:CCGGGGCTTTACCTCGATAGCATAACTCGAGTTATGCTATCGAGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001714.2-3097s1c1
Sequence:CCGGTCGGTTGTTAGATGTACAATTCTCGAGAATTGTACATCTAACAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-1793s1c1
Sequence:CCGGCGGTAGAAACAAGGACCTCATCTCGAGATGAGGTCCTTGTTTCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-2412s1c1
Sequence:CCGGCACTTTGTTACGAATGGCTATCTCGAGATAGCCATTCGTAACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-543s1c1
Sequence:CCGGGAAGGATGAAATCCGAGAATACTCGAGTATTCTCGGATTTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-2071s1c1
Sequence:CCGGGATAAAGACAAGGAAGCCTTACTCGAGTAAGGCTTCCTTGTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-658s1c1
Sequence:CCGGCAGGTTGAATACGAAGGCTTACTCGAGTAAGCCTTCGTATTCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-1434s1c1
Sequence:CCGGGAAGGCCAAGTATGAGAGTAACTCGAGTTACTCTCATACTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-904s1c1
Sequence:CCGGGATGGGAGTGAACCAAACAATCTCGAGATTGTTTGGTTCACTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001714.1-739s1c1
Sequence:CCGGGCCATCCGATTGAAAGAGATTCTCGAGAATCTCTTTCAATCGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001714
VALIDATED
BICD1 MISSION shRNA Lentiviral Transduction Particles
bicaudal D homolog 1 (Drosophila)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-680s21c1
Sequence:CCGGAGCATGAGATTAAGCGATTTGCTCGAGCAAATCGCTTAATCTCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2703s21c1
Sequence:CCGGTTCCTACCTACAGAATTTATTCTCGAGAATAAATTCTGTAGGTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001714.2-3349s21c1
Sequence:CCGGTATATTGCAGTATCATCTTTCCTCGAGGAAAGATGATACTGCAATATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2248s21c1
Sequence:CCGGACCATGACGAAGCTTAGAAATCTCGAGATTTCTAAGCTTCGTCATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-377s21c1
Sequence:CCGGCATCGAAGGAGGCTTACTATCCTCGAGGATAGTAAGCCTCCTTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001714.2-2198s21c1
Sequence:CCGGTAGCTAATCTCAAGAACAAATCTCGAGATTTGTTCTTGAGATTAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219976    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001714.2-3302s1c1
Sequence:CCGGGGCTTTACCTCGATAGCATAACTCGAGTTATGCTATCGAGGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001714.2-3097s1c1
Sequence:CCGGTCGGTTGTTAGATGTACAATTCTCGAGAATTGTACATCTAACAACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-1793s1c1
Sequence:CCGGCGGTAGAAACAAGGACCTCATCTCGAGATGAGGTCCTTGTTTCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-2412s1c1
Sequence:CCGGCACTTTGTTACGAATGGCTATCTCGAGATAGCCATTCGTAACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-543s1c1
Sequence:CCGGGAAGGATGAAATCCGAGAATACTCGAGTATTCTCGGATTTCATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-2071s1c1
Sequence:CCGGGATAAAGACAAGGAAGCCTTACTCGAGTAAGGCTTCCTTGTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001714.1-658s1c1
Sequence:CCGGCAGGTTGAATACGAAGGCTTACTCGAGTAAGCCTTCGTATTCAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-1434s1c1
Sequence:CCGGGAAGGCCAAGTATGAGAGTAACTCGAGTTACTCTCATACTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001714.1-904s1c1
Sequence:CCGGGATGGGAGTGAACCAAACAATCTCGAGATTGTTTGGTTCACTCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_001714.1-739s1c1
Sequence:CCGGGCCATCCGATTGAAAGAGATTCTCGAGAATCTCTTTCAATCGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009753
VALIDATED
BICD1 MISSION shRNA Bacterial Glycerol Stock
bicaudal D homolog 1 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-1631s1c1
Sequence:CCGGGCCGTCACAGAAGTCATTGATCTCGAGATCAATGACTTCTGTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-809s1c1
Sequence:CCGGCTACAGAGAATACGAATGAAACTCGAGTTTCATTCGTATTCTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-3661s1c1
Sequence:CCGGCTAGGTTTCTTCACTAAACATCTCGAGATGTTTAGTGAAGAAACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009753.1-2609s1c1
Sequence:CCGGGCAACAAGATGCGATGAATATCTCGAGATATTCATCGCATCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009753
VALIDATED
BICD1 MISSION shRNA shRNA Plasmid DNA
bicaudal D homolog 1 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-1631s1c1
Sequence:CCGGGCCGTCACAGAAGTCATTGATCTCGAGATCAATGACTTCTGTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-809s1c1
Sequence:CCGGCTACAGAGAATACGAATGAAACTCGAGTTTCATTCGTATTCTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-3661s1c1
Sequence:CCGGCTAGGTTTCTTCACTAAACATCTCGAGATGTTTAGTGAAGAAACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009753.1-2609s1c1
Sequence:CCGGGCAACAAGATGCGATGAATATCTCGAGATATTCATCGCATCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009753
VALIDATED
BICD1 MISSION shRNA Lentiviral Transduction Particles
bicaudal D homolog 1 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-1631s1c1
Sequence:CCGGGCCGTCACAGAAGTCATTGATCTCGAGATCAATGACTTCTGTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-809s1c1
Sequence:CCGGCTACAGAGAATACGAATGAAACTCGAGTTTCATTCGTATTCTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009753.1-3661s1c1
Sequence:CCGGCTAGGTTTCTTCACTAAACATCTCGAGATGTTTAGTGAAGAAACCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009753.1-2609s1c1
Sequence:CCGGGCAACAAGATGCGATGAATATCTCGAGATATTCATCGCATCTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks