EMAIL THIS PAGE TO A FRIEND

BICD2

bicaudal D homolog 2 (Drosophila)

229 Gene Product Result for
Synonyms: SMALED2 bA526D8.1
Gene ID:
Human(23299) Summary: This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
Mouse(76895) bicaudal D homolog 2 (Drosophila)
Rat(306809) bicaudal D homolog 2 (Drosophila)
chicken(415990) bicaudal D homolog 2 (Drosophila)
dog(484214) bicaudal D homolog 2 (Drosophila)
cow(282447) bicaudal D homolog 2 (Drosophila)
Horse(100056101) bicaudal D homolog 2 (Drosophila)
domestic cat(101083373) bicaudal D homolog 2 (Drosophila)
naked mole-rat(101726404) bicaudal D homolog 2 (Drosophila)
domestic guinea pig(100727856) bicaudal D homolog 2 (Drosophila)
sheep(101112119) bicaudal D homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015250 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063341 MISSION® esiRNA esiRNA targeting mouse Bicd2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003800 Rosetta Predictions human pricing
NM_015250 Rosetta Predictions human pricing
NM_001033674 Rosetta Predictions rat pricing
NM_198765 Rosetta Predictions rat pricing
NM_001039179 Rosetta Predictions mouse pricing
NM_001039180 Rosetta Predictions mouse pricing
NM_029791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242588 predicted 1348
2 SASI_Hs01_00242589 predicted 1699
3 SASI_Hs02_00304390 predicted 1949
4 SASI_Hs01_00242590 predicted 2240
5 SASI_Hs01_00242591 predicted 838
6 SASI_Hs01_00242593 predicted 2065
7 SASI_Hs01_00242594 predicted 851
8 SASI_Hs01_00242595 predicted 543
9 SASI_Hs01_00242596 predicted 1334
10 SASI_Hs01_00242597 predicted 560
11 SASI_Hs01_00242592 predicted 2190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026444 predicted 1350
2 SASI_Hs01_00026445 predicted 1705
3 SASI_Hs02_00347386 predicted 1944
4 SASI_Hs01_00026446 predicted 2238
5 SASI_Hs01_00026447 predicted 832
6 SASI_Hs01_00026449 predicted 2060
7 SASI_Hs01_00026450 predicted 844
8 SASI_Hs01_00026451 predicted 546
9 SASI_Hs01_00026452 predicted 1332
10 SASI_Hs01_00026453 predicted 562
11 SASI_Hs01_00026448 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072087 predicted 2139
2 SASI_Rn02_00203684 predicted 1382
3 SASI_Rn01_00072088 predicted 406
4 SASI_Rn01_00072089 predicted 2122
5 SASI_Rn01_00072090 predicted 736
6 SASI_Rn01_00072091 predicted 1351
7 SASI_Rn01_00072092 predicted 924
8 SASI_Rn01_00072093 predicted 1018
9 SASI_Rn01_00072094 predicted 777
10 SASI_Rn01_00072095 predicted 857
11 SASI_Rn01_00072096 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084008 predicted 2122
2 SASI_Rn02_00270008 predicted 1369
3 SASI_Rn01_00084009 predicted 392
4 SASI_Rn01_00084010 predicted 2100
5 SASI_Rn01_00084011 predicted 717
6 SASI_Rn01_00084012 predicted 1336
7 SASI_Rn01_00084013 predicted 899
8 SASI_Rn01_00084014 predicted 996
9 SASI_Rn01_00084015 predicted 754
10 SASI_Rn01_00084016 predicted 839
11 SASI_Rn01_00084017 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048793 predicted 1418
2 SASI_Mm01_00048794 predicted 1910
3 SASI_Mm01_00048795 predicted 768
4 SASI_Mm01_00048796 predicted 1773
5 SASI_Mm01_00048797 predicted 949
6 SASI_Mm01_00048798 predicted 806
7 SASI_Mm01_00048799 predicted 963
8 SASI_Mm01_00048800 predicted 1385
9 SASI_Mm01_00048801 predicted 2282
10 SASI_Mm01_00048802 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289926 predicted 1313
2 SASI_Mm01_00074739 predicted 1808
3 SASI_Mm01_00074740 predicted 670
4 SASI_Mm01_00074741 predicted 1675
5 SASI_Mm01_00074742 predicted 850
6 SASI_Mm01_00074743 predicted 700
7 SASI_Mm01_00074744 predicted 861
8 SASI_Mm01_00074745 predicted 1284
9 SASI_Mm01_00074746 predicted 2170
10 SASI_Mm01_00074747 predicted 1435
11 SASI_Mm01_00074748 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189669 predicted 1414
2 SASI_Mm01_00189670 predicted 1919
3 SASI_Mm01_00189671 predicted 772
4 SASI_Mm01_00189672 predicted 1774
5 SASI_Mm01_00189673 predicted 953
6 SASI_Mm01_00189674 predicted 813
7 SASI_Mm01_00189675 predicted 965
8 SASI_Mm01_00189676 predicted 1383
9 SASI_Mm01_00189677 predicted 2281
10 SASI_Mm01_00189678 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029791
VALIDATED
BICD2 MISSION shRNA Bacterial Glycerol Stock
bicaudal D homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-330s1c1
Sequence:CCGGCCAGGCACATACAAACCACAACTCGAGTTGTGGTTTGTATGTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-2194s1c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-1104s1c1
Sequence:CCGGGCTCCACATATCTGAGATCCACTCGAGTGGATCTCAGATATGTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-800s21c1
Sequence:CCGGAGAGGATGCCATCCGGCTTAACTCGAGTTAAGCCGGATGGCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029791.3-3510s1c1
Sequence:CCGGGCCAAATTGTGGTACACTTAGCTCGAGCTAAGTGTACCACAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1384s21c1
Sequence:CCGGACGAAGACGGTGACTACTATGCTCGAGCATAGTAGTCACCGTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029791.3-3376s21c1
Sequence:CCGGTGAGTAGTATTACCTACAAATCTCGAGATTTGTAGGTAATACTACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1777s21c1
Sequence:CCGGACCGTGTCATGCTCGACTATTCTCGAGAATAGTCGAGCATGACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1343s21c1
Sequence:CCGGGCGACAGACCTCGTTGGATAACTCGAGTTATCCAACGAGGTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029791
VALIDATED
BICD2 MISSION shRNA shRNA Plasmid DNA
bicaudal D homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-330s1c1
Sequence:CCGGCCAGGCACATACAAACCACAACTCGAGTTGTGGTTTGTATGTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-2194s1c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-1104s1c1
Sequence:CCGGGCTCCACATATCTGAGATCCACTCGAGTGGATCTCAGATATGTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-800s21c1
Sequence:CCGGAGAGGATGCCATCCGGCTTAACTCGAGTTAAGCCGGATGGCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029791.3-3510s1c1
Sequence:CCGGGCCAAATTGTGGTACACTTAGCTCGAGCTAAGTGTACCACAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1384s21c1
Sequence:CCGGACGAAGACGGTGACTACTATGCTCGAGCATAGTAGTCACCGTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029791.3-3376s21c1
Sequence:CCGGTGAGTAGTATTACCTACAAATCTCGAGATTTGTAGGTAATACTACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1777s21c1
Sequence:CCGGACCGTGTCATGCTCGACTATTCTCGAGAATAGTCGAGCATGACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1343s21c1
Sequence:CCGGGCGACAGACCTCGTTGGATAACTCGAGTTATCCAACGAGGTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029791
VALIDATED
BICD2 MISSION shRNA Lentiviral Transduction Particles
bicaudal D homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-330s1c1
Sequence:CCGGCCAGGCACATACAAACCACAACTCGAGTTGTGGTTTGTATGTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-2194s1c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029791.2-1104s1c1
Sequence:CCGGGCTCCACATATCTGAGATCCACTCGAGTGGATCTCAGATATGTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-800s21c1
Sequence:CCGGAGAGGATGCCATCCGGCTTAACTCGAGTTAAGCCGGATGGCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217388    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029791.3-3510s1c1
Sequence:CCGGGCCAAATTGTGGTACACTTAGCTCGAGCTAAGTGTACCACAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1384s21c1
Sequence:CCGGACGAAGACGGTGACTACTATGCTCGAGCATAGTAGTCACCGTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029791.3-3376s21c1
Sequence:CCGGTGAGTAGTATTACCTACAAATCTCGAGATTTGTAGGTAATACTACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1777s21c1
Sequence:CCGGACCGTGTCATGCTCGACTATTCTCGAGAATAGTCGAGCATGACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_029791.3-1343s21c1
Sequence:CCGGGCGACAGACCTCGTTGGATAACTCGAGTTATCCAACGAGGTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015250
VALIDATED
BICD2 MISSION shRNA Bacterial Glycerol Stock
bicaudal D homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2537s1c1
Sequence:CCGGGCTGCCAGGAGGACTTGGCCACTCGAGTGGCCAAGTCCTCCTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2182s1c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2312s1c1
Sequence:CCGGCCAGGTGTGACGAGTACATTACTCGAGTAATGTACTCGTCACACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015250.1-837s1c1
Sequence:CCGGGCTGTCACACTACATGAGCATCTCGAGATGCTCATGTAGTGTGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-299s1c1
Sequence:CCGGCCTTTGGACAAGCACACACAACTCGAGTTGTGTGTGCTTGTCCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-837s21c1
Sequence:CCGGGCTGTCACACTACATGAGCATCTCGAGATGCTCATGTAGTGTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-2312s21c1
Sequence:CCGGCCAGGTGTGACGAGTACATTACTCGAGTAATGTACTCGTCACACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-2182s21c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-551s21c1
Sequence:CCGGATGACATCAAGGAGTACAAATCTCGAGATTTGTACTCCTTGATGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015250
VALIDATED
BICD2 MISSION shRNA shRNA Plasmid DNA
bicaudal D homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2537s1c1
Sequence:CCGGGCTGCCAGGAGGACTTGGCCACTCGAGTGGCCAAGTCCTCCTGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2182s1c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2312s1c1
Sequence:CCGGCCAGGTGTGACGAGTACATTACTCGAGTAATGTACTCGTCACACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015250.1-837s1c1
Sequence:CCGGGCTGTCACACTACATGAGCATCTCGAGATGCTCATGTAGTGTGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-299s1c1
Sequence:CCGGCCTTTGGACAAGCACACACAACTCGAGTTGTGTGTGCTTGTCCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-837s21c1
Sequence:CCGGGCTGTCACACTACATGAGCATCTCGAGATGCTCATGTAGTGTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-2312s21c1
Sequence:CCGGCCAGGTGTGACGAGTACATTACTCGAGTAATGTACTCGTCACACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-2182s21c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-551s21c1
Sequence:CCGGATGACATCAAGGAGTACAAATCTCGAGATTTGTACTCCTTGATGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015250
VALIDATED
BICD2 MISSION shRNA Lentiviral Transduction Particles
bicaudal D homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2537s1c1
Sequence:CCGGGCTGCCAGGAGGACTTGGCCACTCGAGTGGCCAAGTCCTCCTGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2182s1c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-2312s1c1
Sequence:CCGGCCAGGTGTGACGAGTACATTACTCGAGTAATGTACTCGTCACACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015250.1-837s1c1
Sequence:CCGGGCTGTCACACTACATGAGCATCTCGAGATGCTCATGTAGTGTGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015250.1-299s1c1
Sequence:CCGGCCTTTGGACAAGCACACACAACTCGAGTTGTGTGTGCTTGTCCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-837s21c1
Sequence:CCGGGCTGTCACACTACATGAGCATCTCGAGATGCTCATGTAGTGTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-2312s21c1
Sequence:CCGGCCAGGTGTGACGAGTACATTACTCGAGTAATGTACTCGTCACACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-2182s21c1
Sequence:CCGGGCCAACCTGAAGAGCAAGTATCTCGAGATACTTGCTCTTCAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_015250.3-551s21c1
Sequence:CCGGATGACATCAAGGAGTACAAATCTCGAGATTTGTACTCCTTGATGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)