EMAIL THIS PAGE TO A FRIEND

BID

BH3 interacting domain death agonist

96 Gene Product Result for
Synonyms: FP497
UniProtKB ID: P55957, Q549M7, Q71T04, Q7Z4M9, Q8IY86
Gene ID:
Human(637) Summary: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Mouse(12122) BH3 interacting domain death agonist
Rat(64625) BH3 interacting domain death agonist
chicken(395236) BH3 interacting domain death agonist
cow(510373) BH3 interacting domain death agonist
cow(782484) BH3 interacting domain death agonist transcript-like
domestic cat(100502578) BH3 interacting domain death agonist
dog(100683675) BH3 interacting domain death agonist
domestic guinea pig(100728186) BH3 interacting domain death agonist
naked mole-rat(101710493) BH3 interacting domain death agonist
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105416 Anti-BID (51-65) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2500159 Anti-BID antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB3500353 Anti-Bid antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
B3183 Anti-BID antibody produced in rabbit Cleavage site [59/60] specific, affinity isolated antibody, buffered aqueous glycerol solution mouse
microarray, western blot pricing
HPA000722 Anti-BID antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
B4305 Anti-BID antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, microarray, western blot pricing
SAB1303068 ANTI-MOUSE BID (S61) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
flow cytometry, immunohistochemistry, western blot pricing
SAB1303562 ANTI-MOUSE PHOSPHO-BID-S61 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB4503900 Anti-phospho-BID (pSer78) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
WH0000637M1 Monoclonal Anti-BID antibody produced in mouse clone 3F3-1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403605 Monoclonal Anti-BID antibody produced in mouse clone 3E8-1B10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300512 Monoclonal Anti-BID antibody produced in mouse clone 3C5, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001196 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007544 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007544 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007544 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001196 Rosetta Predictions human pricing
NM_197966 Rosetta Predictions human pricing
NM_197967 Rosetta Predictions human pricing
NM_022684 Rosetta Predictions rat pricing
NM_007544 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047470 predicted 800
2 SASI_Hs02_00331335 predicted 715
3 SASI_Hs01_00047472 predicted 662
4 SASI_Hs01_00047473 predicted 656
5 SASI_Hs01_00047474 predicted 833
6 SASI_Hs01_00047475 predicted 667
7 SASI_Hs01_00047476 predicted 765
8 SASI_Hs01_00047477 predicted 735
9 SASI_Hs01_00047478 predicted 711
10 SASI_Hs01_00047479 predicted 401
11 SASI_Hs01_00047471 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208323 predicted 1091
2 SASI_Hs02_00371578 predicted 1006
3 SASI_Hs01_00208325 predicted 958
4 SASI_Hs01_00208326 predicted 953
5 SASI_Hs01_00208327 predicted 1125
6 SASI_Hs01_00208328 predicted 954
7 SASI_Hs01_00208329 predicted 1059
8 SASI_Hs01_00208330 predicted 1026
9 SASI_Hs01_00208331 predicted 1005
10 SASI_Hs01_00208332 predicted 695
11 SASI_Hs01_00208324 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129266 predicted 729
2 SASI_Hs01_00129268 predicted 641
3 SASI_Hs01_00129269 predicted 598
4 SASI_Hs01_00129270 predicted 590
5 SASI_Hs01_00129271 predicted 763
6 SASI_Hs01_00129272 predicted 600
7 SASI_Hs01_00129273 predicted 691
8 SASI_Hs01_00129274 predicted 665
9 SASI_Hs01_00129275 predicted 648
10 SASI_Hs02_00371579 predicted 601
11 SASI_Hs01_00129267 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043867 predicted 201
2 SASI_Rn01_00043869 predicted 794
3 SASI_Rn01_00043870 predicted 776
4 SASI_Rn01_00043871 predicted 661
5 SASI_Rn01_00043872 predicted 630
6 SASI_Rn01_00043873 predicted 586
7 SASI_Rn01_00043874 predicted 211
8 SASI_Rn01_00043875 predicted 462
9 SASI_Rn01_00043876 predicted 405
10 SASI_Rn02_00263469 predicted 362
11 SASI_Rn01_00043868 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007544 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115198 predicted 885
2 SASI_Mm01_00115200 predicted 925
3 SASI_Mm01_00115201 predicted 396
4 SASI_Mm01_00115202 predicted 661
5 SASI_Mm01_00115203 predicted 809
6 SASI_Mm01_00115204 predicted 622
7 SASI_Mm01_00115205 predicted 361
8 SASI_Mm01_00115206 predicted 576
9 SASI_Mm02_00311882 predicted 407
10 SASI_Mm02_00311883 predicted 700
11 SASI_Mm01_00115199 predicted 781
12 SASI_Mm01_00115207 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001196
VALIDATED
BID MISSION shRNA Bacterial Glycerol Stock
BH3 interacting domain death agonist
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-203s21c1
Sequence:CCGGCAGGGATGAGTGCATCACAAACTCGAGTTTGTGATGCACTCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-680s21c1
Sequence:CCGGCTTTCACACAACAGTGAATTTCTCGAGAAATTCACTGTTGTGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-726s21c1
Sequence:CCGGGTGAGGAGCTTAGCCAGAAATCTCGAGATTTCTGGCTAAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001196.2-960s21c1
Sequence:CCGGATGTCCATTTACACGTATTTGCTCGAGCAAATACGTGTAAATGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-408s21c1
Sequence:CCGGGAAGACATCATCCGGAATATTCTCGAGAATATTCCGGATGATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-242s1c1
Sequence:CCGGCCTCCAAAGCTGTTCTGACAACTCGAGTTGTCAGAACAGCTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001196.2-680s1c1
Sequence:CCGGCTTTCACACAACAGTGAATTTCTCGAGAAATTCACTGTTGTGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-726s1c1
Sequence:CCGGGTGAGGAGCTTAGCCAGAAATCTCGAGATTTCTGGCTAAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-203s1c1
Sequence:CCGGCAGGGATGAGTGCATCACAAACTCGAGTTTGTGATGCACTCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-376s1c1
Sequence:CCGGTGGGAAGAATAGAGGCAGATTCTCGAGAATCTGCCTCTATTCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001196
VALIDATED
BID MISSION shRNA shRNA Plasmid DNA
BH3 interacting domain death agonist
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-203s21c1
Sequence:CCGGCAGGGATGAGTGCATCACAAACTCGAGTTTGTGATGCACTCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-680s21c1
Sequence:CCGGCTTTCACACAACAGTGAATTTCTCGAGAAATTCACTGTTGTGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-726s21c1
Sequence:CCGGGTGAGGAGCTTAGCCAGAAATCTCGAGATTTCTGGCTAAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001196.2-960s21c1
Sequence:CCGGATGTCCATTTACACGTATTTGCTCGAGCAAATACGTGTAAATGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-408s21c1
Sequence:CCGGGAAGACATCATCCGGAATATTCTCGAGAATATTCCGGATGATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-242s1c1
Sequence:CCGGCCTCCAAAGCTGTTCTGACAACTCGAGTTGTCAGAACAGCTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001196.2-680s1c1
Sequence:CCGGCTTTCACACAACAGTGAATTTCTCGAGAAATTCACTGTTGTGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-726s1c1
Sequence:CCGGGTGAGGAGCTTAGCCAGAAATCTCGAGATTTCTGGCTAAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-203s1c1
Sequence:CCGGCAGGGATGAGTGCATCACAAACTCGAGTTTGTGATGCACTCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-376s1c1
Sequence:CCGGTGGGAAGAATAGAGGCAGATTCTCGAGAATCTGCCTCTATTCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001196
VALIDATED
BID MISSION shRNA Lentiviral Transduction Particles
BH3 interacting domain death agonist
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-203s21c1
Sequence:CCGGCAGGGATGAGTGCATCACAAACTCGAGTTTGTGATGCACTCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-680s21c1
Sequence:CCGGCTTTCACACAACAGTGAATTTCTCGAGAAATTCACTGTTGTGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-726s21c1
Sequence:CCGGGTGAGGAGCTTAGCCAGAAATCTCGAGATTTCTGGCTAAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001196.2-960s21c1
Sequence:CCGGATGTCCATTTACACGTATTTGCTCGAGCAAATACGTGTAAATGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001196.2-408s21c1
Sequence:CCGGGAAGACATCATCCGGAATATTCTCGAGAATATTCCGGATGATGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-242s1c1
Sequence:CCGGCCTCCAAAGCTGTTCTGACAACTCGAGTTGTCAGAACAGCTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001196.2-680s1c1
Sequence:CCGGCTTTCACACAACAGTGAATTTCTCGAGAAATTCACTGTTGTGTGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-726s1c1
Sequence:CCGGGTGAGGAGCTTAGCCAGAAATCTCGAGATTTCTGGCTAAGCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-203s1c1
Sequence:CCGGCAGGGATGAGTGCATCACAAACTCGAGTTTGTGATGCACTCATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001196.2-376s1c1
Sequence:CCGGTGGGAAGAATAGAGGCAGATTCTCGAGAATCTGCCTCTATTCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007544
VALIDATED
BID MISSION shRNA Bacterial Glycerol Stock
BH3 interacting domain death agonist
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-572s21c1
Sequence:CCGGACGACAAGGCCATGCTGATAACTCGAGTTATCAGCATGGCCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-877s21c1
Sequence:CCGGTGCGTTCAGCTTGAGTGTATCCTCGAGGATACACTCAAGCTGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-654s21c1
Sequence:CCGGCCACACGACTGTCAACTTTATCTCGAGATAAAGTTGACAGTCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-467s21c1
Sequence:CCGGTAGCCGCACAGTTCATGAATGCTCGAGCATTCATGAACTGTGCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-400s21c1
Sequence:CCGGGCCAGACATCTCGCCCAAATACTCGAGTATTTGGGCGAGATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007544.2-670s1c1
Sequence:CCGGCCACACGACTGTCAACTTTATCTCGAGATAAAGTTGACAGTCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007544.2-2009s1c1
Sequence:CCGGCCACTAACAAACTGAGTTTAACTCGAGTTAAACTCAGTTTGTTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007544.2-416s1c1
Sequence:CCGGGCCAGACATCTCGCCCAAATACTCGAGTATTTGGGCGAGATGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007544.2-601s1c1
Sequence:CCGGGCTGATAATGACCATGCTGTTCTCGAGAACAGCATGGTCATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007544.2-351s1c1
Sequence:CCGGGCTCCTTCAACCAAGGAAGAACTCGAGTTCTTCCTTGGTTGAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007544
VALIDATED
BID MISSION shRNA shRNA Plasmid DNA
BH3 interacting domain death agonist
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-572s21c1
Sequence:CCGGACGACAAGGCCATGCTGATAACTCGAGTTATCAGCATGGCCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-877s21c1
Sequence:CCGGTGCGTTCAGCTTGAGTGTATCCTCGAGGATACACTCAAGCTGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-654s21c1
Sequence:CCGGCCACACGACTGTCAACTTTATCTCGAGATAAAGTTGACAGTCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-467s21c1
Sequence:CCGGTAGCCGCACAGTTCATGAATGCTCGAGCATTCATGAACTGTGCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-400s21c1
Sequence:CCGGGCCAGACATCTCGCCCAAATACTCGAGTATTTGGGCGAGATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007544.2-670s1c1
Sequence:CCGGCCACACGACTGTCAACTTTATCTCGAGATAAAGTTGACAGTCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007544.2-2009s1c1
Sequence:CCGGCCACTAACAAACTGAGTTTAACTCGAGTTAAACTCAGTTTGTTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007544.2-416s1c1
Sequence:CCGGGCCAGACATCTCGCCCAAATACTCGAGTATTTGGGCGAGATGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007544.2-601s1c1
Sequence:CCGGGCTGATAATGACCATGCTGTTCTCGAGAACAGCATGGTCATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007544.2-351s1c1
Sequence:CCGGGCTCCTTCAACCAAGGAAGAACTCGAGTTCTTCCTTGGTTGAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007544
VALIDATED
BID MISSION shRNA Lentiviral Transduction Particles
BH3 interacting domain death agonist
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-572s21c1
Sequence:CCGGACGACAAGGCCATGCTGATAACTCGAGTTATCAGCATGGCCTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-877s21c1
Sequence:CCGGTGCGTTCAGCTTGAGTGTATCCTCGAGGATACACTCAAGCTGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-654s21c1
Sequence:CCGGCCACACGACTGTCAACTTTATCTCGAGATAAAGTTGACAGTCGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-467s21c1
Sequence:CCGGTAGCCGCACAGTTCATGAATGCTCGAGCATTCATGAACTGTGCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007544.3-400s21c1
Sequence:CCGGGCCAGACATCTCGCCCAAATACTCGAGTATTTGGGCGAGATGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007544.2-670s1c1
Sequence:CCGGCCACACGACTGTCAACTTTATCTCGAGATAAAGTTGACAGTCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007544.2-2009s1c1
Sequence:CCGGCCACTAACAAACTGAGTTTAACTCGAGTTAAACTCAGTTTGTTAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007544.2-416s1c1
Sequence:CCGGGCCAGACATCTCGCCCAAATACTCGAGTATTTGGGCGAGATGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007544.2-601s1c1
Sequence:CCGGGCTGATAATGACCATGCTGTTCTCGAGAACAGCATGGTCATTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007544.2-351s1c1
Sequence:CCGGGCTCCTTCAACCAAGGAAGAACTCGAGTTCTTCCTTGGTTGAAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks