EMAIL THIS PAGE TO A FRIEND

BIK

BCL2-interacting killer (apoptosis-inducing)

59 Gene Product Result for
Synonyms: BIP1 BP4 NBK
UniProtKB ID: Q13323, Q16582, Q6FH93
Gene ID:
Human(638) Summary: The protein encoded by this gene shares a critical BH3 domain with other death-promoting proteins, such as BID, BAK, BAD and BAX, that is required for its pro-apoptotic activity, and for interaction with anti-apoptotic members of the BCL2 family, and viral survival-promoting proteins. Since the activity of this protein is suppressed in the presence of survival-promoting proteins, it is suggested as a likely target for anti-apoptotic proteins. [provided by RefSeq, Sep 2011]
Mouse(12124) BCL2-interacting killer
Rat(114496) BCL2-interacting killer (apoptosis-inducing)
sheep(101116389) BCL2-interacting killer (apoptosis-inducing)
naked mole-rat(101714141) BCL2-interacting killer (apoptosis-inducing)
domestic guinea pig(101788697) BCL2-interacting killer (apoptosis-inducing)
Zebrafish(564030) BCL2-interacting killer (apoptosis-inducing)
cow(618614) BCL2-interacting killer (apoptosis-inducing)
domestic cat(790946) BCL2-interacting killer (apoptosis-inducing)
chicken(776149) BCL2-interacting killer (apoptosis-inducing)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001197 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003941 MISSION® esiRNA esiRNA targeting mouse Bik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001197 Rosetta Predictions human pricing
NM_053704 Rosetta Predictions rat pricing
NM_007546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001197 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127428 predicted 223
2 SASI_Hs01_00127430 predicted 761
3 SASI_Hs02_00331336 predicted 880
4 SASI_Hs01_00127431 predicted 341
5 SASI_Hs01_00127432 predicted 672
6 SASI_Hs02_00331337 predicted 326
7 SASI_Hs01_00127434 predicted 883
8 SASI_Hs01_00127435 predicted 354
9 SASI_Hs01_00127436 predicted 769
10 SASI_Hs01_00127437 predicted 756
11 SASI_Hs01_00127429 predicted 184
12 SASI_Hs01_00127433 predicted 132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084550 predicted 423
2 SASI_Rn01_00084551 predicted 220
3 SASI_Rn01_00084554 predicted 385
4 SASI_Rn02_00266472 predicted 228
5 SASI_Rn01_00084555 predicted 364
6 SASI_Rn01_00084557 predicted 226
7 SASI_Rn01_00084558 predicted 226
8 SASI_Rn02_00266473 predicted 342
9 SASI_Rn02_00266474 predicted 223
10 SASI_Rn01_00084559 predicted 382
11 SASI_Rn01_00084552 predicted 432
12 SASI_Rn01_00084553 predicted 435
13 SASI_Rn01_00084556 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311886 predicted 335
2 SASI_Mm02_00311887 predicted 342
3 SASI_Mm02_00311888 predicted 376
4 SASI_Mm02_00311889 predicted 340
5 SASI_Mm02_00311890 predicted 291
6 SASI_Mm02_00311891 predicted 381
7 SASI_Mm02_00311892 predicted 294
8 SASI_Mm02_00311893 predicted 335
9 SASI_Mm02_00311894 predicted 296
10 SASI_Mm02_00311895 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007546
BIK MISSION shRNA Bacterial Glycerol Stock
BCL2-interacting killer (apoptosis-inducing)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-510s1c1
Sequence:CCGGCCTGGTATTTGCAGCTTCAGTCTCGAGACTGAAGCTGCAAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-339s1c1
Sequence:CCGGGCCGGACAGGTGTCAGAGGTACTCGAGTACCTCTGACACCTGTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007546.1-652s1c1
Sequence:CCGGGCTGAGATTTCATACAGGTTTCTCGAGAAACCTGTATGAAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-370s1c1
Sequence:CCGGCTTGATTCGAAGCCTCACCAACTCGAGTTGGTGAGGCTTCGAATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-312s1c1
Sequence:CCGGCTATACACAGACTCGCTGTCACTCGAGTGACAGCGAGTCTGTGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-207s21c1
Sequence:CCGGGAGTGCGTGGAAGGCAGAAACCTCGAGGTTTCTGCCTTCCACGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-258s21c1
Sequence:CCGGGATGAGATGGACCTGTGTCTGCTCGAGCAGACACAGGTCCATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007546.2-702s21c1
Sequence:CCGGACTGTACCTCAGGAGCATTACCTCGAGGTAATGCTCCTGAGGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-174s21c1
Sequence:CCGGATGAAGGAGCCTGTGAGAGACCTCGAGGTCTCTCACAGGCTCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007546
BIK MISSION shRNA shRNA Plasmid DNA
BCL2-interacting killer (apoptosis-inducing)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-510s1c1
Sequence:CCGGCCTGGTATTTGCAGCTTCAGTCTCGAGACTGAAGCTGCAAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-339s1c1
Sequence:CCGGGCCGGACAGGTGTCAGAGGTACTCGAGTACCTCTGACACCTGTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007546.1-652s1c1
Sequence:CCGGGCTGAGATTTCATACAGGTTTCTCGAGAAACCTGTATGAAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-370s1c1
Sequence:CCGGCTTGATTCGAAGCCTCACCAACTCGAGTTGGTGAGGCTTCGAATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-312s1c1
Sequence:CCGGCTATACACAGACTCGCTGTCACTCGAGTGACAGCGAGTCTGTGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-207s21c1
Sequence:CCGGGAGTGCGTGGAAGGCAGAAACCTCGAGGTTTCTGCCTTCCACGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-258s21c1
Sequence:CCGGGATGAGATGGACCTGTGTCTGCTCGAGCAGACACAGGTCCATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007546.2-702s21c1
Sequence:CCGGACTGTACCTCAGGAGCATTACCTCGAGGTAATGCTCCTGAGGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-174s21c1
Sequence:CCGGATGAAGGAGCCTGTGAGAGACCTCGAGGTCTCTCACAGGCTCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007546
BIK MISSION shRNA Lentiviral Transduction Particles
BCL2-interacting killer (apoptosis-inducing)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-510s1c1
Sequence:CCGGCCTGGTATTTGCAGCTTCAGTCTCGAGACTGAAGCTGCAAATACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-339s1c1
Sequence:CCGGGCCGGACAGGTGTCAGAGGTACTCGAGTACCTCTGACACCTGTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009682    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007546.1-652s1c1
Sequence:CCGGGCTGAGATTTCATACAGGTTTCTCGAGAAACCTGTATGAAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-370s1c1
Sequence:CCGGCTTGATTCGAAGCCTCACCAACTCGAGTTGGTGAGGCTTCGAATCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007546.1-312s1c1
Sequence:CCGGCTATACACAGACTCGCTGTCACTCGAGTGACAGCGAGTCTGTGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-207s21c1
Sequence:CCGGGAGTGCGTGGAAGGCAGAAACCTCGAGGTTTCTGCCTTCCACGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-258s21c1
Sequence:CCGGGATGAGATGGACCTGTGTCTGCTCGAGCAGACACAGGTCCATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007546.2-702s21c1
Sequence:CCGGACTGTACCTCAGGAGCATTACCTCGAGGTAATGCTCCTGAGGTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007546.2-174s21c1
Sequence:CCGGATGAAGGAGCCTGTGAGAGACCTCGAGGTCTCTCACAGGCTCCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001197
BIK MISSION shRNA Bacterial Glycerol Stock
BCL2-interacting killer (apoptosis-inducing)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-192s1c1
Sequence:CCGGCTTCGATTCTTTGGAATGCATCTCGAGATGCATTCCAAAGAATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-395s1c1
Sequence:CCGGCCACACTTAAGGAGAACATAACTCGAGTTATGTTCTCCTTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-148s1c1
Sequence:CCGGCTTGGCATGACTGACTCTGAACTCGAGTTCAGAGTCAGTCATGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-383s1c1
Sequence:CCGGTGGACGGTTTCACCACACTTACTCGAGTAAGTGTGGTGAAACCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001197.3-602s21c1
Sequence:CCGGGCGGCCTGCTGCTGTTATCTTCTCGAGAAGATAACAGCAGCAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001197.3-92s21c1
Sequence:CCGGTCTTGATGGAGACCCTCCTGTCTCGAGACAGGAGGGTCTCCATCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001197
BIK MISSION shRNA shRNA Plasmid DNA
BCL2-interacting killer (apoptosis-inducing)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-192s1c1
Sequence:CCGGCTTCGATTCTTTGGAATGCATCTCGAGATGCATTCCAAAGAATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-395s1c1
Sequence:CCGGCCACACTTAAGGAGAACATAACTCGAGTTATGTTCTCCTTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-148s1c1
Sequence:CCGGCTTGGCATGACTGACTCTGAACTCGAGTTCAGAGTCAGTCATGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-383s1c1
Sequence:CCGGTGGACGGTTTCACCACACTTACTCGAGTAAGTGTGGTGAAACCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001197.3-602s21c1
Sequence:CCGGGCGGCCTGCTGCTGTTATCTTCTCGAGAAGATAACAGCAGCAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001197.3-92s21c1
Sequence:CCGGTCTTGATGGAGACCCTCCTGTCTCGAGACAGGAGGGTCTCCATCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001197
BIK MISSION shRNA Lentiviral Transduction Particles
BCL2-interacting killer (apoptosis-inducing)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-192s1c1
Sequence:CCGGCTTCGATTCTTTGGAATGCATCTCGAGATGCATTCCAAAGAATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-395s1c1
Sequence:CCGGCCACACTTAAGGAGAACATAACTCGAGTTATGTTCTCCTTAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-148s1c1
Sequence:CCGGCTTGGCATGACTGACTCTGAACTCGAGTTCAGAGTCAGTCATGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001197.3-383s1c1
Sequence:CCGGTGGACGGTTTCACCACACTTACTCGAGTAAGTGTGGTGAAACCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001197.3-602s21c1
Sequence:CCGGGCGGCCTGCTGCTGTTATCTTCTCGAGAAGATAACAGCAGCAGGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001197.3-92s21c1
Sequence:CCGGTCTTGATGGAGACCCTCCTGTCTCGAGACAGGAGGGTCTCCATCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks