EMAIL THIS PAGE TO A FRIEND

BIN1

bridging integrator 1

Synonyms: AMPH2 AMPHL SH3P9
Gene ID:
Human(274) Summary: This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in ten transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. [provided by RefSeq, Sep 2011]
Mouse(30948) bridging integrator 1
Rat(117028) bridging integrator 1
Zebrafish(447863) bridging integrator 1
Horse(100052213) bridging integrator 1
cow(614576) bridging integrator 1
domestic cat(101097908) bridging integrator 1
fruit fly(41965) Bicoid interacting protein 1
dog(483870) bridging integrator 1
chicken(424228) bridging integrator 1
domestic guinea pig(100722858) bridging integrator 1
naked mole-rat(101723039) bridging integrator 1
sheep(101119119) bridging integrator 1
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500163 Anti-BIN1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, bovine, mouse
ELISA, western blot pricing
SAB2108424 Anti-BIN1 antibody produced in rabbit affinity isolated antibody rabbit, mouse, horse, human
western blot pricing
HPA005437 Anti-BIN1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA003894 Anti-BIN1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1408547 Anti-BIN1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107117 Anti-BIN1 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rabbit, human, horse
ELISA, western blot pricing
SAB2107118 Anti-BIN1 antibody produced in rabbit affinity isolated antibody horse, mouse, rabbit, human, guinea pig
ELISA, western blot pricing
B9428 Monoclonal Anti-Bin1 antibody produced in mouse clone 99D, ascites fluid human, mouse, rat, avian, rabbit
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
WH0000274M1 Monoclonal Anti-BIN1 antibody produced in mouse clone 1H1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403549 Monoclonal Anti-BIN1, (C-terminal) antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004305 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004305 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004305 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004305 Rosetta Predictions human pricing
NM_139343 Rosetta Predictions human pricing
NM_139344 Rosetta Predictions human pricing
NM_139345 Rosetta Predictions human pricing
NM_139346 Rosetta Predictions human pricing
NM_139347 Rosetta Predictions human pricing
NM_139348 Rosetta Predictions human pricing
NM_139349 Rosetta Predictions human pricing
NM_139350 Rosetta Predictions human pricing
NM_139351 Rosetta Predictions human pricing
NM_053959 Rosetta Predictions rat pricing
NM_001083334 Rosetta Predictions mouse pricing
NM_009668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004305 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052359 predicted 614
2 SASI_Hs01_00052360 predicted 558
3 SASI_Hs01_00052361 predicted 458
4 SASI_Hs02_00337327 predicted 450
5 SASI_Hs01_00052362 predicted 561
6 SASI_Hs01_00052363 predicted 535
7 SASI_Hs01_00052364 predicted 548
8 SASI_Hs01_00052365 predicted 593
9 SASI_Hs01_00052366 predicted 594
10 SASI_Hs01_00052367 predicted 638
11 SASI_Hs01_00052358 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200197 predicted 615
2 SASI_Hs01_00200198 predicted 561
3 SASI_Hs01_00200199 predicted 457
4 SASI_Hs02_00364302 predicted 445
5 SASI_Hs01_00200200 predicted 560
6 SASI_Hs01_00200201 predicted 536
7 SASI_Hs01_00200202 predicted 554
8 SASI_Hs01_00200203 predicted 587
9 SASI_Hs01_00200204 predicted 593
10 SASI_Hs01_00200205 predicted 637
11 SASI_Hs01_00200196 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244425 predicted 610
2 SASI_Hs01_00244426 predicted 558
3 SASI_Hs01_00244427 predicted 451
4 SASI_Hs02_00364303 predicted 444
5 SASI_Hs01_00244428 predicted 561
6 SASI_Hs01_00244429 predicted 536
7 SASI_Hs01_00244430 predicted 553
8 SASI_Hs01_00244431 predicted 590
9 SASI_Hs01_00244432 predicted 591
10 SASI_Hs01_00244433 predicted 641
11 SASI_Hs01_00244424 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018045 predicted 615
2 SASI_Hs01_00018046 predicted 560
3 SASI_Hs01_00018047 predicted 453
4 SASI_Hs02_00364304 predicted 450
5 SASI_Hs01_00018048 predicted 564
6 SASI_Hs01_00018049 predicted 540
7 SASI_Hs01_00018050 predicted 556
8 SASI_Hs01_00018051 predicted 588
9 SASI_Hs01_00018052 predicted 592
10 SASI_Hs01_00018053 predicted 642
11 SASI_Hs01_00018044 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083191 predicted 615
2 SASI_Hs01_00083192 predicted 563
3 SASI_Hs01_00083193 predicted 456
4 SASI_Hs02_00364305 predicted 449
5 SASI_Hs01_00083194 predicted 564
6 SASI_Hs01_00083195 predicted 534
7 SASI_Hs01_00083196 predicted 554
8 SASI_Hs01_00083197 predicted 590
9 SASI_Hs01_00083198 predicted 594
10 SASI_Hs01_00083199 predicted 641
11 SASI_Hs01_00083190 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138305 predicted 613
2 SASI_Hs01_00138306 predicted 556
3 SASI_Hs01_00138307 predicted 453
4 SASI_Hs02_00364306 predicted 448
5 SASI_Hs01_00138308 predicted 562
6 SASI_Hs01_00138309 predicted 536
7 SASI_Hs01_00138310 predicted 553
8 SASI_Hs01_00138311 predicted 592
9 SASI_Hs01_00138312 predicted 592
10 SASI_Hs01_00138313 predicted 635
11 SASI_Hs01_00138304 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176781 predicted 618
2 SASI_Hs01_00176782 predicted 564
3 SASI_Hs01_00176783 predicted 450
4 SASI_Hs02_00364307 predicted 451
5 SASI_Hs01_00176784 predicted 563
6 SASI_Hs01_00176785 predicted 541
7 SASI_Hs01_00176786 predicted 553
8 SASI_Hs01_00176787 predicted 589
9 SASI_Hs01_00176788 predicted 592
10 SASI_Hs01_00176789 predicted 640
11 SASI_Hs01_00176780 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053756 predicted 618
2 SASI_Hs01_00053757 predicted 559
3 SASI_Hs01_00053758 predicted 457
4 SASI_Hs02_00364308 predicted 446
5 SASI_Hs01_00053759 predicted 560
6 SASI_Hs01_00053760 predicted 536
7 SASI_Hs01_00053761 predicted 554
8 SASI_Hs01_00053762 predicted 590
9 SASI_Hs01_00053763 predicted 594
10 SASI_Hs01_00053764 predicted 642
11 SASI_Hs01_00053755 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029149 predicted 617
2 SASI_Hs01_00029150 predicted 560
3 SASI_Hs01_00029151 predicted 455
4 SASI_Hs02_00364309 predicted 443
5 SASI_Hs01_00029152 predicted 562
6 SASI_Hs01_00029153 predicted 541
7 SASI_Hs01_00029154 predicted 550
8 SASI_Hs01_00029155 predicted 590
9 SASI_Hs01_00029156 predicted 589
10 SASI_Hs01_00029157 predicted 636
11 SASI_Hs01_00029148 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244415 predicted 616
2 SASI_Hs01_00244416 predicted 564
3 SASI_Hs01_00244417 predicted 454
4 SASI_Hs02_00364310 predicted 442
5 SASI_Hs01_00244418 predicted 565
6 SASI_Hs01_00244419 predicted 538
7 SASI_Hs01_00244420 predicted 550
8 SASI_Hs01_00244421 predicted 596
9 SASI_Hs01_00244422 predicted 594
10 SASI_Hs01_00244423 predicted 640
11 SASI_Hs01_00244414 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102283 predicted 821
2 SASI_Rn01_00102284 predicted 440
3 SASI_Rn02_00266922 predicted 728
4 SASI_Rn01_00102285 predicted 945
5 SASI_Rn01_00102286 predicted 1186
6 SASI_Rn01_00102287 predicted 1672
7 SASI_Rn01_00102288 predicted 316
8 SASI_Rn01_00102289 predicted 705
9 SASI_Rn01_00102290 predicted 585
10 SASI_Rn01_00102291 predicted 684
11 SASI_Rn01_00102292 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299681 predicted 915
2 SASI_Mm02_00299682 predicted 386
3 SASI_Mm02_00299683 predicted 433
4 SASI_Mm02_00299684 predicted 377
5 SASI_Mm02_00299685 predicted 382
6 SASI_Mm02_00299686 predicted 422
7 SASI_Mm02_00299687 predicted 1438
8 SASI_Mm02_00299688 predicted 426
9 SASI_Mm02_00299689 predicted 414
10 SASI_Mm02_00299690 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316694 predicted 1014
2 SASI_Mm01_00177655 predicted 386
3 SASI_Mm02_00316695 predicted 433
4 SASI_Mm02_00316696 predicted 381
5 SASI_Mm02_00316697 predicted 373
6 SASI_Mm02_00316698 predicted 416
7 SASI_Mm02_00316699 predicted 1768
8 SASI_Mm02_00316700 predicted 424
9 SASI_Mm02_00316701 predicted 410
10 SASI_Mm01_00177663 predicted 366
11 SASI_Mm01_00177654 predicted 954
12 SASI_Mm01_00177656 predicted 1798
13 SASI_Mm01_00177657 predicted 449
14 SASI_Mm01_00177658 predicted 843
15 SASI_Mm01_00177659 predicted 1842
16 SASI_Mm01_00177660 predicted 1348
17 SASI_Mm01_00177661 predicted 812
18 SASI_Mm01_00177662 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004305
VALIDATED
BIN1 MISSION shRNA Bacterial Glycerol Stock
bridging integrator 1
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-881s21c1
Sequence:GTACCGGTCAAAGCCCAGAAGGTGTTTGCTCGAGCAAACACCTTCTGGGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-745s21c1
Sequence:CCGGCCCGACATCAAGTCACGCATTCTCGAGAATGCGTGACTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-666s21c1
Sequence:CCGGCGACCTGCTGTGGATGGATTACTCGAGTAATCCATCCACAGCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-1932s21c1
Sequence:CCGGTGTGTCCTCTAGTTGAGTTTCCTCGAGGAAACTCAACTAGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-596s21c1
Sequence:CCGGAGTGTCTGCAGGAGGTGTATGCTCGAGCATACACCTCCTGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-810s21c1
Sequence:CCGGCCACTACGAGTCCCTTCAAACCTCGAGGTTTGAAGGGACTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004305.2-1847s21c1
Sequence:GTACCGGGGGCGTTCTCCCAAAGATTAGCTCGAGCTAATCTTTGGGAGAACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-477s21c1
Sequence:GTACCGGTGAGCAGTGCGTCCAGAATTTCTCGAGAAATTCTGGACGCACTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-1077s21c1
Sequence:GTACCGGGAGCAACACCTTCACGGTCAACTCGAGTTGACCGTGAAGGTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004305.2-1805s21c1
Sequence:GTACCGGTTGAAGAGCAAAGGGAAATCACTCGAGTGATTTCCCTTTGCTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-945s21c1
Sequence:GTACCGGGAACAGCCGCGTAGGTTTCTACTCGAGTAGAAACCTACGCGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-1486s21c1
Sequence:GTACCGGGGTTTCATGTTCAAGGTACAGCTCGAGCTGTACCTTGAACATGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-642s21c1
Sequence:GTACCGGGGCAAACAAGATCGCAGAGAACTCGAGTTCTCTGCGATCTTGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004305.2-1023s1c1
Sequence:CCGGCAAGCTCAACCAGAACCTCAACTCGAGTTGAGGTTCTGGTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004305.2-745s1c1
Sequence:CCGGCCCGACATCAAGTCACGCATTCTCGAGAATGCGTGACTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004305.2-457s1c1
Sequence:CCGGGAGACCAAGGATGAGCAGTTTCTCGAGAAACTGCTCATCCTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004305.2-1483s1c1
Sequence:CCGGCCAGGTTTCATGTTCAAGGTACTCGAGTACCTTGAACATGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004305.2-1854s1c1
Sequence:CCGGCTCCCAAAGATTAGGTCGTTTCTCGAGAAACGACCTAATCTTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004305
VALIDATED
BIN1 MISSION shRNA shRNA Plasmid DNA
bridging integrator 1
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-881s21c1
Sequence:GTACCGGTCAAAGCCCAGAAGGTGTTTGCTCGAGCAAACACCTTCTGGGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-745s21c1
Sequence:CCGGCCCGACATCAAGTCACGCATTCTCGAGAATGCGTGACTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-666s21c1
Sequence:CCGGCGACCTGCTGTGGATGGATTACTCGAGTAATCCATCCACAGCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-1932s21c1
Sequence:CCGGTGTGTCCTCTAGTTGAGTTTCCTCGAGGAAACTCAACTAGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-596s21c1
Sequence:CCGGAGTGTCTGCAGGAGGTGTATGCTCGAGCATACACCTCCTGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-810s21c1
Sequence:CCGGCCACTACGAGTCCCTTCAAACCTCGAGGTTTGAAGGGACTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004305.2-1847s21c1
Sequence:GTACCGGGGGCGTTCTCCCAAAGATTAGCTCGAGCTAATCTTTGGGAGAACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-477s21c1
Sequence:GTACCGGTGAGCAGTGCGTCCAGAATTTCTCGAGAAATTCTGGACGCACTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-1077s21c1
Sequence:GTACCGGGAGCAACACCTTCACGGTCAACTCGAGTTGACCGTGAAGGTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004305.2-1805s21c1
Sequence:GTACCGGTTGAAGAGCAAAGGGAAATCACTCGAGTGATTTCCCTTTGCTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-945s21c1
Sequence:GTACCGGGAACAGCCGCGTAGGTTTCTACTCGAGTAGAAACCTACGCGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-1486s21c1
Sequence:GTACCGGGGTTTCATGTTCAAGGTACAGCTCGAGCTGTACCTTGAACATGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-642s21c1
Sequence:GTACCGGGGCAAACAAGATCGCAGAGAACTCGAGTTCTCTGCGATCTTGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004305.2-1023s1c1
Sequence:CCGGCAAGCTCAACCAGAACCTCAACTCGAGTTGAGGTTCTGGTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004305.2-745s1c1
Sequence:CCGGCCCGACATCAAGTCACGCATTCTCGAGAATGCGTGACTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004305.2-457s1c1
Sequence:CCGGGAGACCAAGGATGAGCAGTTTCTCGAGAAACTGCTCATCCTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004305.2-1483s1c1
Sequence:CCGGCCAGGTTTCATGTTCAAGGTACTCGAGTACCTTGAACATGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004305.2-1854s1c1
Sequence:CCGGCTCCCAAAGATTAGGTCGTTTCTCGAGAAACGACCTAATCTTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004305
VALIDATED
BIN1 MISSION shRNA Lentiviral Transduction Particles
bridging integrator 1
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-881s21c1
Sequence:GTACCGGTCAAAGCCCAGAAGGTGTTTGCTCGAGCAAACACCTTCTGGGCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-745s21c1
Sequence:CCGGCCCGACATCAAGTCACGCATTCTCGAGAATGCGTGACTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-666s21c1
Sequence:CCGGCGACCTGCTGTGGATGGATTACTCGAGTAATCCATCCACAGCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-1932s21c1
Sequence:CCGGTGTGTCCTCTAGTTGAGTTTCCTCGAGGAAACTCAACTAGAGGACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-596s21c1
Sequence:CCGGAGTGTCTGCAGGAGGTGTATGCTCGAGCATACACCTCCTGCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004305.2-810s21c1
Sequence:CCGGCCACTACGAGTCCCTTCAAACCTCGAGGTTTGAAGGGACTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004305.2-1847s21c1
Sequence:GTACCGGGGGCGTTCTCCCAAAGATTAGCTCGAGCTAATCTTTGGGAGAACGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-477s21c1
Sequence:GTACCGGTGAGCAGTGCGTCCAGAATTTCTCGAGAAATTCTGGACGCACTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-1077s21c1
Sequence:GTACCGGGAGCAACACCTTCACGGTCAACTCGAGTTGACCGTGAAGGTGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004305.2-1805s21c1
Sequence:GTACCGGTTGAAGAGCAAAGGGAAATCACTCGAGTGATTTCCCTTTGCTCTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-945s21c1
Sequence:GTACCGGGAACAGCCGCGTAGGTTTCTACTCGAGTAGAAACCTACGCGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-1486s21c1
Sequence:GTACCGGGGTTTCATGTTCAAGGTACAGCTCGAGCTGTACCTTGAACATGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004305.2-642s21c1
Sequence:GTACCGGGGCAAACAAGATCGCAGAGAACTCGAGTTCTCTGCGATCTTGTTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004305.2-1023s1c1
Sequence:CCGGCAAGCTCAACCAGAACCTCAACTCGAGTTGAGGTTCTGGTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004305.2-745s1c1
Sequence:CCGGCCCGACATCAAGTCACGCATTCTCGAGAATGCGTGACTTGATGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004305.2-457s1c1
Sequence:CCGGGAGACCAAGGATGAGCAGTTTCTCGAGAAACTGCTCATCCTTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004305.2-1483s1c1
Sequence:CCGGCCAGGTTTCATGTTCAAGGTACTCGAGTACCTTGAACATGAAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118037    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004305.2-1854s1c1
Sequence:CCGGCTCCCAAAGATTAGGTCGTTTCTCGAGAAACGACCTAATCTTTGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009668
VALIDATED
BIN1 MISSION shRNA Bacterial Glycerol Stock
bridging integrator 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-1418s21c1
Sequence:GTACCGGACACCCTCTGGTCAGTCAATCCTCGAGGATTGACTGACCAGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-1970s21c1
Sequence:CCGGCCCGAGTGTGAAGAACCTTTCCTCGAGGAAAGGTTCTTCACACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-779s21c1
Sequence:CCGGCAAACTAACCTGCTCCGAAATCTCGAGATTTCGGAGCAGGTTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-388s21c1
Sequence:CCGGGACCTATCTGGCTTCTGTTAACTCGAGTTAACAGAAGCCAGATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-303s21c1
Sequence:CCGGAGACGAAGGACGAGCAGTTTGCTCGAGCAAACTGCTCGTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-1806s21c1
Sequence:CCGGGCGATGTGGTGTTGGTGATTCCTCGAGGAATCACCAACACCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009668.2-2158s21c1
Sequence:GTACCGGTCAGTGGACTTCTCCAGTGTTCTCGAGAACACTGGAGAAGTCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-1782s21c1
Sequence:GTACCGGCTGATGAGCTGCAACTCAAAGCTCGAGCTTTGAGTTGCAGCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-963s21c1
Sequence:GTACCGGAGCTCAATCAGAACCTCAATGCTCGAGCATTGAGGTTCTGATTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009668.1-2151s1c1
Sequence:CCGGGAAACCTAAGCCAAGAGGTATCTCGAGATACCTCTTGGCTTAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1789s1c1
Sequence:CCGGCCGGGATTCATGTTCAAGGTTCTCGAGAACCTTGAACATGAATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1001s1c1
Sequence:CCGGACTTCCATAAAGAGATGAGTACTCGAGTACTCATCTCTTTATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009668.1-649s1c1
Sequence:CCGGCCTGATATCAAGTCGCGCATTCTCGAGAATGCGCGACTTGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1341s1c1
Sequence:CCGGTGACGCATTTGTCCCTGAGATCTCGAGATCTCAGGGACAAATGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009668
VALIDATED
BIN1 MISSION shRNA shRNA Plasmid DNA
bridging integrator 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-1418s21c1
Sequence:GTACCGGACACCCTCTGGTCAGTCAATCCTCGAGGATTGACTGACCAGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-1970s21c1
Sequence:CCGGCCCGAGTGTGAAGAACCTTTCCTCGAGGAAAGGTTCTTCACACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-779s21c1
Sequence:CCGGCAAACTAACCTGCTCCGAAATCTCGAGATTTCGGAGCAGGTTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-388s21c1
Sequence:CCGGGACCTATCTGGCTTCTGTTAACTCGAGTTAACAGAAGCCAGATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-303s21c1
Sequence:CCGGAGACGAAGGACGAGCAGTTTGCTCGAGCAAACTGCTCGTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-1806s21c1
Sequence:CCGGGCGATGTGGTGTTGGTGATTCCTCGAGGAATCACCAACACCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009668.2-2158s21c1
Sequence:GTACCGGTCAGTGGACTTCTCCAGTGTTCTCGAGAACACTGGAGAAGTCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-1782s21c1
Sequence:GTACCGGCTGATGAGCTGCAACTCAAAGCTCGAGCTTTGAGTTGCAGCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-963s21c1
Sequence:GTACCGGAGCTCAATCAGAACCTCAATGCTCGAGCATTGAGGTTCTGATTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009668.1-2151s1c1
Sequence:CCGGGAAACCTAAGCCAAGAGGTATCTCGAGATACCTCTTGGCTTAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1789s1c1
Sequence:CCGGCCGGGATTCATGTTCAAGGTTCTCGAGAACCTTGAACATGAATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1001s1c1
Sequence:CCGGACTTCCATAAAGAGATGAGTACTCGAGTACTCATCTCTTTATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009668.1-649s1c1
Sequence:CCGGCCTGATATCAAGTCGCGCATTCTCGAGAATGCGCGACTTGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1341s1c1
Sequence:CCGGTGACGCATTTGTCCCTGAGATCTCGAGATCTCAGGGACAAATGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009668
VALIDATED
BIN1 MISSION shRNA Lentiviral Transduction Particles
bridging integrator 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-1418s21c1
Sequence:GTACCGGACACCCTCTGGTCAGTCAATCCTCGAGGATTGACTGACCAGAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238138    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-1970s21c1
Sequence:CCGGCCCGAGTGTGAAGAACCTTTCCTCGAGGAAAGGTTCTTCACACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-779s21c1
Sequence:CCGGCAAACTAACCTGCTCCGAAATCTCGAGATTTCGGAGCAGGTTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-388s21c1
Sequence:CCGGGACCTATCTGGCTTCTGTTAACTCGAGTTAACAGAAGCCAGATAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-303s21c1
Sequence:CCGGAGACGAAGGACGAGCAGTTTGCTCGAGCAAACTGCTCGTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009668.2-1806s21c1
Sequence:CCGGGCGATGTGGTGTTGGTGATTCCTCGAGGAATCACCAACACCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009668.2-2158s21c1
Sequence:GTACCGGTCAGTGGACTTCTCCAGTGTTCTCGAGAACACTGGAGAAGTCCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-1782s21c1
Sequence:GTACCGGCTGATGAGCTGCAACTCAAAGCTCGAGCTTTGAGTTGCAGCTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009668.2-963s21c1
Sequence:GTACCGGAGCTCAATCAGAACCTCAATGCTCGAGCATTGAGGTTCTGATTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009668.1-2151s1c1
Sequence:CCGGGAAACCTAAGCCAAGAGGTATCTCGAGATACCTCTTGGCTTAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1789s1c1
Sequence:CCGGCCGGGATTCATGTTCAAGGTTCTCGAGAACCTTGAACATGAATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1001s1c1
Sequence:CCGGACTTCCATAAAGAGATGAGTACTCGAGTACTCATCTCTTTATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009668.1-649s1c1
Sequence:CCGGCCTGATATCAAGTCGCGCATTCTCGAGAATGCGCGACTTGATATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009668.1-1341s1c1
Sequence:CCGGTGACGCATTTGTCCCTGAGATCTCGAGATCTCAGGGACAAATGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks