EMAIL THIS PAGE TO A FRIEND

BIN2

bridging integrator 2

109 Gene Product Result for
Synonyms: BRAP-1
UniProtKB ID: Q9UBW5, Q86VV0, Q9NWK4, Q9UKN4
Gene ID:
Mouse(668218) bridging integrator 2
Rat(366988) bridging integrator 2
Thale Cress(827605) Shaggy-related protein kinase eta
dog(486539) bridging integrator 2
chicken(777552) bridging integrator 2
domestic cat(101095183) bridging integrator 2
cow(515025) bridging integrator 2
Horse(100060850) bridging integrator 2
sheep(101114507) bridging integrator 2
naked mole-rat(101703695) bridging integrator 2
domestic guinea pig(100734562) bridging integrator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016187 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054951 MISSION® esiRNA esiRNA human BIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016293 Rosetta Predictions human pricing
NM_001012223 Rosetta Predictions rat pricing
XM_578696 Rosetta Predictions rat pricing
XM_001000082 Rosetta Predictions mouse pricing
XM_001476911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196220 predicted 349
2 SASI_Hs02_00349217 predicted 992
3 SASI_Hs01_00196221 predicted 591
4 SASI_Hs01_00196222 predicted 1805
5 SASI_Hs01_00196223 predicted 863
6 SASI_Hs01_00196224 predicted 249
7 SASI_Hs01_00196225 predicted 905
8 SASI_Hs01_00196226 predicted 878
9 SASI_Hs01_00196227 predicted 1610
10 SASI_Hs01_00196228 predicted 633
11 SASI_Hs01_00196229 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052660 predicted 1527
2 SASI_Rn01_00052661 predicted 638
3 SASI_Rn01_00052662 predicted 415
4 SASI_Rn01_00052663 predicted 760
5 SASI_Rn01_00052664 predicted 783
6 SASI_Rn01_00052665 predicted 725
7 SASI_Rn01_00052666 predicted 245
8 SASI_Rn01_00052667 predicted 1623
9 SASI_Rn02_00200481 predicted 1551
10 SASI_Rn01_00052668 predicted 833
11 SASI_Rn01_00052669 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164958 predicted 676
2 SASI_Rn01_00164959 predicted 453
3 SASI_Rn01_00164960 predicted 584
4 SASI_Rn01_00164961 predicted 377
5 SASI_Rn01_00164962 predicted 719
6 SASI_Rn01_00164963 predicted 731
7 SASI_Rn01_00164964 predicted 226
8 SASI_Rn01_00164965 predicted 738
9 SASI_Rn01_00164966 predicted 619
10 SASI_Rn01_00164967 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254601 predicted 733
2 SASI_Mm02_00354584 predicted 690
3 SASI_Mm02_00354585 predicted 710
4 SASI_Mm02_00354586 predicted 685
5 SASI_Mm02_00354587 predicted 655
6 SASI_Mm02_00354588 predicted 721
7 SASI_Mm01_00254604 predicted 720
8 SASI_Mm02_00354589 predicted 743
9 SASI_Mm02_00354590 predicted 723
10 SASI_Mm02_00354591 predicted 647
11 SASI_Mm01_00254602 predicted 1514
12 SASI_Mm01_00254603 predicted 1509
13 SASI_Mm01_00254605 predicted 216
14 SASI_Mm01_00254606 predicted 553
15 SASI_Mm01_00254607 predicted 448
16 SASI_Mm01_00254608 predicted 593
17 SASI_Mm01_00254609 predicted 1522
18 SASI_Mm01_00254610 predicted 1588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00392137 predicted 199
2 SASI_Mm02_00392138 predicted 586
3 SASI_Mm02_00392139 predicted 464
4 SASI_Mm02_00392140 predicted 713
5 SASI_Mm02_00392141 predicted 617
6 SASI_Mm02_00392142 predicted 689
7 SASI_Mm02_00392143 predicted 391
8 SASI_Mm02_00392144 predicted 403
9 SASI_Mm02_00392145 predicted 584
10 SASI_Mm02_00392146 predicted 479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016187
BIN2 MISSION shRNA Bacterial Glycerol Stock
bridging integrator 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016187.1-1752s1c1
Sequence:CCGGGCTCTTCAACCAGAGGGTATACTCGAGTATACCCTCTGGTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-308s1c1
Sequence:CCGGGAAGGCCATCGTATGGAATAACTCGAGTTATTCCATACGATGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-723s1c1
Sequence:CCGGGAGAAGCAACATTCCAATAAACTCGAGTTTATTGGAATGTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016187.1-1971s1c1
Sequence:CCGGCATTAACTAAAGTGGAGCTTTCTCGAGAAAGCTCCACTTTAGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-312s1c1
Sequence:CCGGGCCATCGTATGGAATAATGATCTCGAGATCATTATTCCATACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-114s1c1
Sequence:CCGGGCTGTAGAAACCAAAGATGAACTCGAGTTCATCTTTGGTTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-1666s1c1
Sequence:CCGGCTCAAGAAGAGGTATCCACAACTCGAGTTGTGGATACCTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-525s1c1
Sequence:CCGGGCAGAGGAAGAGTTCAACAAACTCGAGTTTGTTGAACTCTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-862s1c1
Sequence:CCGGCCTTGAAGAGTGAGAGTGAATCTCGAGATTCACTCTCACTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016187
BIN2 MISSION shRNA shRNA Plasmid DNA
bridging integrator 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016187.1-1752s1c1
Sequence:CCGGGCTCTTCAACCAGAGGGTATACTCGAGTATACCCTCTGGTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-308s1c1
Sequence:CCGGGAAGGCCATCGTATGGAATAACTCGAGTTATTCCATACGATGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-723s1c1
Sequence:CCGGGAGAAGCAACATTCCAATAAACTCGAGTTTATTGGAATGTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016187.1-1971s1c1
Sequence:CCGGCATTAACTAAAGTGGAGCTTTCTCGAGAAAGCTCCACTTTAGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-312s1c1
Sequence:CCGGGCCATCGTATGGAATAATGATCTCGAGATCATTATTCCATACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-114s1c1
Sequence:CCGGGCTGTAGAAACCAAAGATGAACTCGAGTTCATCTTTGGTTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-1666s1c1
Sequence:CCGGCTCAAGAAGAGGTATCCACAACTCGAGTTGTGGATACCTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-525s1c1
Sequence:CCGGGCAGAGGAAGAGTTCAACAAACTCGAGTTTGTTGAACTCTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-862s1c1
Sequence:CCGGCCTTGAAGAGTGAGAGTGAATCTCGAGATTCACTCTCACTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016187
BIN2 MISSION shRNA Lentiviral Transduction Particles
bridging integrator 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016187.1-1752s1c1
Sequence:CCGGGCTCTTCAACCAGAGGGTATACTCGAGTATACCCTCTGGTTGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-308s1c1
Sequence:CCGGGAAGGCCATCGTATGGAATAACTCGAGTTATTCCATACGATGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-723s1c1
Sequence:CCGGGAGAAGCAACATTCCAATAAACTCGAGTTTATTGGAATGTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160378    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016187.1-1971s1c1
Sequence:CCGGCATTAACTAAAGTGGAGCTTTCTCGAGAAAGCTCCACTTTAGTTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-312s1c1
Sequence:CCGGGCCATCGTATGGAATAATGATCTCGAGATCATTATTCCATACGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-114s1c1
Sequence:CCGGGCTGTAGAAACCAAAGATGAACTCGAGTTCATCTTTGGTTTCTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-1666s1c1
Sequence:CCGGCTCAAGAAGAGGTATCCACAACTCGAGTTGTGGATACCTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-525s1c1
Sequence:CCGGGCAGAGGAAGAGTTCAACAAACTCGAGTTTGTTGAACTCTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016187.1-862s1c1
Sequence:CCGGCCTTGAAGAGTGAGAGTGAATCTCGAGATTCACTCTCACTCTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks