EMAIL THIS PAGE TO A FRIEND

BIN3-IT1

BIN3 intronic transcript 1 (non-protein coding)

32 Gene Product Result for
Species: Human BIN3-IT1(80094)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025026 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025026 Rosetta Predictions human pricing
XR_017962 Rosetta Predictions human pricing
XR_041874 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177917 predicted 516
2 SASI_Hs01_00177918 predicted 1248
3 SASI_Hs01_00177919 predicted 1072
4 SASI_Hs01_00177920 predicted 1334
5 SASI_Hs01_00177921 predicted 1091
6 SASI_Hs01_00177922 predicted 1343
7 SASI_Hs01_00177923 predicted 1208
8 SASI_Hs01_00177924 predicted 521
9 SASI_Hs01_00177925 predicted 1363
10 SASI_Hs01_00177926 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495097 predicted 421
2 SASI_Hs02_00495098 predicted 560
3 SASI_Hs02_00495099 predicted 221
4 SASI_Hs02_00495100 predicted 488
5 SASI_Hs02_00495101 predicted 363
6 SASI_Hs02_00495102 predicted 560
7 SASI_Hs02_00495103 predicted 500
8 SASI_Hs02_00495104 predicted 436
9 SASI_Hs02_00495105 predicted 306
10 SASI_Hs02_00495106 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531112 predicted 417
2 SASI_Hs02_00531113 predicted 566
3 SASI_Hs02_00531114 predicted 224
4 SASI_Hs02_00531115 predicted 493
5 SASI_Hs02_00531116 predicted 362
6 SASI_Hs02_00531117 predicted 564
7 SASI_Hs02_00531118 predicted 501
8 SASI_Hs02_00531119 predicted 436
9 SASI_Hs02_00531120 predicted 311
10 SASI_Hs02_00531121 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025026
BIN3-IT1 MISSION shRNA Bacterial Glycerol Stock
BIN3 intronic transcript 1 (non-protein coding)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000173097    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025026.1-1532s1c1
Sequence:CCGGCCTGTGTGTTCTGGATCTCTACTCGAGTAGAGATCCAGAACACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025026.1-711s1c1
Sequence:CCGGGCATAAGTTTGGGTGGGAACTCTCGAGAGTTCCCACCCAAACTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025026.1-599s1c1
Sequence:CCGGCTTCCCAGAATGCTGAGGATTCTCGAGAATCCTCAGCATTCTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025026.1-1640s1c1
Sequence:CCGGGCTGTCATATCCTGCAAGGTTCTCGAGAACCTTGCAGGATATGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025026
BIN3-IT1 MISSION shRNA shRNA Plasmid DNA
BIN3 intronic transcript 1 (non-protein coding)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000173097    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025026.1-1532s1c1
Sequence:CCGGCCTGTGTGTTCTGGATCTCTACTCGAGTAGAGATCCAGAACACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025026.1-711s1c1
Sequence:CCGGGCATAAGTTTGGGTGGGAACTCTCGAGAGTTCCCACCCAAACTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025026.1-599s1c1
Sequence:CCGGCTTCCCAGAATGCTGAGGATTCTCGAGAATCCTCAGCATTCTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025026.1-1640s1c1
Sequence:CCGGGCTGTCATATCCTGCAAGGTTCTCGAGAACCTTGCAGGATATGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025026
BIN3-IT1 MISSION shRNA Lentiviral Transduction Particles
BIN3 intronic transcript 1 (non-protein coding)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000173097    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025026.1-1532s1c1
Sequence:CCGGCCTGTGTGTTCTGGATCTCTACTCGAGTAGAGATCCAGAACACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025026.1-711s1c1
Sequence:CCGGGCATAAGTTTGGGTGGGAACTCTCGAGAGTTCCCACCCAAACTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025026.1-599s1c1
Sequence:CCGGCTTCCCAGAATGCTGAGGATTCTCGAGAATCCTCAGCATTCTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025026.1-1640s1c1
Sequence:CCGGGCTGTCATATCCTGCAAGGTTCTCGAGAACCTTGCAGGATATGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)