EMAIL THIS PAGE TO A FRIEND

BIN3

bridging integrator 3

72 Gene Product Result for
UniProtKB ID: Q9NQY0, Q9BVG2, Q9NVY9
Gene ID:
Human(55909) Summary: The product of this gene is a member of the BAR domain protein family. The encoded protein is comprised solely of a BAR domain which is predicted to form coiled-coil structures and proposed to mediate dimerization, sense and induce membrane curvature, and bind small GTPases. BAR domain proteins have been implicated in endocytosis, intracellular transport, and a diverse set of other processes. [provided by RefSeq, Jul 2008]
Mouse(57784) bridging integrator 3
Rat(361065) bridging integrator 3
Zebrafish(323976) bridging integrator 3
cow(507115) bridging integrator 3
domestic cat(101086967) bridging integrator 3
dog(608969) bridging integrator 3
fruit fly(35552) bicoid-interacting protein 3
domestic guinea pig(100728582) bridging integrator 3
naked mole-rat(101725264) bridging integrator 3
sheep(101114242) bridging integrator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018688 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016071 MISSION® esiRNA esiRNA targeting human BIN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018688 Rosetta Predictions human pricing
NM_001013186 Rosetta Predictions rat pricing
NM_021328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174449 predicted 268
2 SASI_Hs01_00174450 predicted 705
3 SASI_Hs01_00174451 predicted 267
4 SASI_Hs02_00352205 predicted 477
5 SASI_Hs01_00174452 predicted 949
6 SASI_Hs01_00174454 predicted 1194
7 SASI_Hs01_00174455 predicted 366
8 SASI_Hs02_00352206 predicted 973
9 SASI_Hs01_00174456 predicted 709
10 SASI_Hs01_00174457 predicted 838
11 SASI_Hs01_00174453 predicted 379
12 SASI_Hs01_00174458 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056221 predicted 916
2 SASI_Rn01_00056224 predicted 889
3 SASI_Rn01_00056225 predicted 609
4 SASI_Rn01_00056226 predicted 621
5 SASI_Rn01_00056227 predicted 533
6 SASI_Rn02_00200946 predicted 505
7 SASI_Rn01_00056228 predicted 1170
8 SASI_Rn01_00056229 predicted 981
9 SASI_Rn01_00056230 predicted 982
10 SASI_Rn02_00200947 predicted 832
11 SASI_Rn01_00056222 predicted 363
12 SASI_Rn01_00056223 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074572 predicted 359
2 SASI_Mm01_00074573 predicted 269
3 SASI_Mm01_00074574 predicted 923
4 SASI_Mm01_00074575 predicted 1016
5 SASI_Mm01_00074576 predicted 1076
6 SASI_Mm01_00074577 predicted 1303
7 SASI_Mm01_00074578 predicted 1019
8 SASI_Mm01_00074579 predicted 1297
9 SASI_Mm01_00074580 predicted 838
10 SASI_Mm01_00074581 predicted 945
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018688
VALIDATED
BIN3 MISSION shRNA Bacterial Glycerol Stock
bridging integrator 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-334s1c1
Sequence:CCGGCCAGATCCAGAAGACTGTGATCTCGAGATCACAGTCTTCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-211s1c1
Sequence:CCGGGAAGATATCCTTGGACTTACTCTCGAGAGTAAGTCCAAGGATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018688.3-64s1c1
Sequence:CCGGCAAGAAACAGATTGTGCCCAACTCGAGTTGGGCACAATCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-915s1c1
Sequence:CCGGCCTTTGCAATGAATGACTCTTCTCGAGAAGAGTCATTCATTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018688.3-87s1c1
Sequence:CCGGCAGTGGAGAGAGACTTTGAAACTCGAGTTTCAAAGTCTCTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-1502s1c1
Sequence:CCGGCCACATAGTATTGTGCTGTAACTCGAGTTACAGCACAATACTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018688.3-209s1c1
Sequence:CCGGGTGAAGATATCCTTGGACTTACTCGAGTAAGTCCAAGGATATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-277s21c1
Sequence:CCGGGAAGATATCCTTGGACTTACTCTCGAGAGTAAGTCCAAGGATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-366s21c1
Sequence:CCGGAGCGGATGGATGCCTTCAATCCTCGAGGATTGAAGGCATCCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-726s21c1
Sequence:CCGGCGGAAATGCACAAGATCTTTGCTCGAGCAAAGATCTTGTGCATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018688.4-842s21c1
Sequence:CCGGATTGTGGCCGATGACTGAATCCTCGAGGATTCAGTCATCGGCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-1200s21c1
Sequence:CCGGCATGCGTTGTGGGCATCAAATCTCGAGATTTGATGCCCACAACGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018688
VALIDATED
BIN3 MISSION shRNA shRNA Plasmid DNA
bridging integrator 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-334s1c1
Sequence:CCGGCCAGATCCAGAAGACTGTGATCTCGAGATCACAGTCTTCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-211s1c1
Sequence:CCGGGAAGATATCCTTGGACTTACTCTCGAGAGTAAGTCCAAGGATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018688.3-64s1c1
Sequence:CCGGCAAGAAACAGATTGTGCCCAACTCGAGTTGGGCACAATCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-915s1c1
Sequence:CCGGCCTTTGCAATGAATGACTCTTCTCGAGAAGAGTCATTCATTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018688.3-87s1c1
Sequence:CCGGCAGTGGAGAGAGACTTTGAAACTCGAGTTTCAAAGTCTCTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-1502s1c1
Sequence:CCGGCCACATAGTATTGTGCTGTAACTCGAGTTACAGCACAATACTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018688.3-209s1c1
Sequence:CCGGGTGAAGATATCCTTGGACTTACTCGAGTAAGTCCAAGGATATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-277s21c1
Sequence:CCGGGAAGATATCCTTGGACTTACTCTCGAGAGTAAGTCCAAGGATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-366s21c1
Sequence:CCGGAGCGGATGGATGCCTTCAATCCTCGAGGATTGAAGGCATCCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-726s21c1
Sequence:CCGGCGGAAATGCACAAGATCTTTGCTCGAGCAAAGATCTTGTGCATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018688.4-842s21c1
Sequence:CCGGATTGTGGCCGATGACTGAATCCTCGAGGATTCAGTCATCGGCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-1200s21c1
Sequence:CCGGCATGCGTTGTGGGCATCAAATCTCGAGATTTGATGCCCACAACGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018688
VALIDATED
BIN3 MISSION shRNA Lentiviral Transduction Particles
bridging integrator 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-334s1c1
Sequence:CCGGCCAGATCCAGAAGACTGTGATCTCGAGATCACAGTCTTCTGGATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-211s1c1
Sequence:CCGGGAAGATATCCTTGGACTTACTCTCGAGAGTAAGTCCAAGGATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018688.3-64s1c1
Sequence:CCGGCAAGAAACAGATTGTGCCCAACTCGAGTTGGGCACAATCTGTTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-915s1c1
Sequence:CCGGCCTTTGCAATGAATGACTCTTCTCGAGAAGAGTCATTCATTGCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018688.3-87s1c1
Sequence:CCGGCAGTGGAGAGAGACTTTGAAACTCGAGTTTCAAAGTCTCTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018688.3-1502s1c1
Sequence:CCGGCCACATAGTATTGTGCTGTAACTCGAGTTACAGCACAATACTATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018688.3-209s1c1
Sequence:CCGGGTGAAGATATCCTTGGACTTACTCGAGTAAGTCCAAGGATATCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-277s21c1
Sequence:CCGGGAAGATATCCTTGGACTTACTCTCGAGAGTAAGTCCAAGGATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-366s21c1
Sequence:CCGGAGCGGATGGATGCCTTCAATCCTCGAGGATTGAAGGCATCCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-726s21c1
Sequence:CCGGCGGAAATGCACAAGATCTTTGCTCGAGCAAAGATCTTGTGCATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018688.4-842s21c1
Sequence:CCGGATTGTGGCCGATGACTGAATCCTCGAGGATTCAGTCATCGGCCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285461    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_018688.4-1200s21c1
Sequence:CCGGCATGCGTTGTGGGCATCAAATCTCGAGATTTGATGCCCACAACGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021328
VALIDATED
BIN3 MISSION shRNA Bacterial Glycerol Stock
bridging integrator 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021328.2-152s1c1
Sequence:CCGGGCAAACTAAACGCCTGCAGAACTCGAGTTCTGCAGGCGTTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-938s1c1
Sequence:CCGGCCTTGCCAGTTCTCTGACTTACTCGAGTAAGTCAGAGAACTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-1353s1c1
Sequence:CCGGGCTGTCCACTAGGAAATGTTACTCGAGTAACATTTCCTAGTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-552s1c1
Sequence:CCGGGAAGACTTTGAGGCCAAGAATCTCGAGATTCTTGGCCTCAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-673s21c1
Sequence:CCGGCAGAAATGCATAAGATCTTTGCTCGAGCAAAGATCTTATGCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-295s21c1
Sequence:CCGGCCCTAGACACAGCCATGAAACCTCGAGGTTTCATGGCTGTGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021328.3-1353s21c1
Sequence:CCGGGCTGTCCACTAGGAAATGTTACTCGAGTAACATTTCCTAGTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-647s21c1
Sequence:CCGGGATCCGGGCACAGGTTATATACTCGAGTATATAACCTGTGCCCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-555s21c1
Sequence:CCGGGACTTTGAGGCCAAGAATAAACTCGAGTTTATTCTTGGCCTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021328.3-938s21c1
Sequence:CCGGCCTTGCCAGTTCTCTGACTTACTCGAGTAAGTCAGAGAACTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021328
VALIDATED
BIN3 MISSION shRNA shRNA Plasmid DNA
bridging integrator 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021328.2-152s1c1
Sequence:CCGGGCAAACTAAACGCCTGCAGAACTCGAGTTCTGCAGGCGTTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-938s1c1
Sequence:CCGGCCTTGCCAGTTCTCTGACTTACTCGAGTAAGTCAGAGAACTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-1353s1c1
Sequence:CCGGGCTGTCCACTAGGAAATGTTACTCGAGTAACATTTCCTAGTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-552s1c1
Sequence:CCGGGAAGACTTTGAGGCCAAGAATCTCGAGATTCTTGGCCTCAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-673s21c1
Sequence:CCGGCAGAAATGCATAAGATCTTTGCTCGAGCAAAGATCTTATGCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-295s21c1
Sequence:CCGGCCCTAGACACAGCCATGAAACCTCGAGGTTTCATGGCTGTGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021328.3-1353s21c1
Sequence:CCGGGCTGTCCACTAGGAAATGTTACTCGAGTAACATTTCCTAGTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-647s21c1
Sequence:CCGGGATCCGGGCACAGGTTATATACTCGAGTATATAACCTGTGCCCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-555s21c1
Sequence:CCGGGACTTTGAGGCCAAGAATAAACTCGAGTTTATTCTTGGCCTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021328.3-938s21c1
Sequence:CCGGCCTTGCCAGTTCTCTGACTTACTCGAGTAAGTCAGAGAACTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021328
VALIDATED
BIN3 MISSION shRNA Lentiviral Transduction Particles
bridging integrator 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021328.2-152s1c1
Sequence:CCGGGCAAACTAAACGCCTGCAGAACTCGAGTTCTGCAGGCGTTTAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-938s1c1
Sequence:CCGGCCTTGCCAGTTCTCTGACTTACTCGAGTAAGTCAGAGAACTGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-1353s1c1
Sequence:CCGGGCTGTCCACTAGGAAATGTTACTCGAGTAACATTTCCTAGTGGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021328.2-552s1c1
Sequence:CCGGGAAGACTTTGAGGCCAAGAATCTCGAGATTCTTGGCCTCAAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-673s21c1
Sequence:CCGGCAGAAATGCATAAGATCTTTGCTCGAGCAAAGATCTTATGCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-295s21c1
Sequence:CCGGCCCTAGACACAGCCATGAAACCTCGAGGTTTCATGGCTGTGTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021328.3-1353s21c1
Sequence:CCGGGCTGTCCACTAGGAAATGTTACTCGAGTAACATTTCCTAGTGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-647s21c1
Sequence:CCGGGATCCGGGCACAGGTTATATACTCGAGTATATAACCTGTGCCCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021328.3-555s21c1
Sequence:CCGGGACTTTGAGGCCAAGAATAAACTCGAGTTTATTCTTGGCCTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021328.3-938s21c1
Sequence:CCGGCCTTGCCAGTTCTCTGACTTACTCGAGTAAGTCAGAGAACTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks