EMAIL THIS PAGE TO A FRIEND

BIRC2

baculoviral IAP repeat containing 2

80 Gene Product Result for
Synonyms: API1 HIAP2 Hiap-2 MIHB RNF48 c-IAP1 cIAP1
UniProtKB ID: Q13490, B4E026, Q16516, Q4TTG0
Gene ID:
Human(329) Summary: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(11797) baculoviral IAP repeat-containing 2
Rat(60371) baculoviral IAP repeat-containing 2
Zebrafish(373107) baculoviral IAP repeat-containing 2
cow(787171) baculoviral IAP repeat containing 2
Horse(100061273) baculoviral IAP repeat containing 2
domestic cat(101101663) baculoviral IAP repeat containing 2
dog(479464) baculoviral IAP repeat containing 2
chicken(374012) baculoviral IAP repeat containing 2
sheep(101119930) baculoviral IAP repeat containing 2
Domestic Rabbit(100338118) baculoviral IAP repeat containing 2
naked mole-rat(101718804) baculoviral IAP repeat containing 2
domestic guinea pig(100715527) baculoviral IAP repeat containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1369 Human cIAP-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001166 Rosetta Predictions human pricing
NM_021752 Rosetta Predictions rat pricing
NM_007465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167908 predicted 2394
2 SASI_Hs01_00167909 predicted 1775
3 SASI_Hs01_00167910 predicted 1702
4 SASI_Hs01_00167911 predicted 2897
5 SASI_Hs02_00331282 predicted 2946
6 SASI_Hs01_00167912 predicted 3092
7 SASI_Hs01_00167913 predicted 1923
8 SASI_Hs02_00331283 predicted 1702
9 SASI_Hs01_00167914 predicted 1898
10 SASI_Hs01_00167915 predicted 1674
11 SASI_Hs01_00167916 predicted 1976
12 SASI_Hs01_00167917 predicted 2650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262811 predicted 2491
2 SASI_Rn01_00113742 predicted 1321
3 SASI_Rn01_00113743 predicted 2185
4 SASI_Rn01_00113744 predicted 2473
5 SASI_Rn01_00113745 predicted 2438
6 SASI_Rn01_00113746 predicted 2150
7 SASI_Rn01_00113747 predicted 1562
8 SASI_Rn01_00113741 predicted 2477
9 SASI_Rn01_00113749 predicted 1034
10 SASI_Rn01_00113750 predicted 1126
11 SASI_Rn01_00113748 predicted 2880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154347 predicted 1146
2 SASI_Mm01_00154348 predicted 2337
3 SASI_Mm01_00154349 predicted 2593
4 SASI_Mm01_00154350 predicted 1328
5 SASI_Mm01_00154351 predicted 1563
6 SASI_Mm01_00154352 predicted 2043
7 SASI_Mm01_00154353 predicted 2454
8 SASI_Mm01_00154354 predicted 2661
9 SASI_Mm01_00154355 predicted 1769
10 SASI_Mm02_00311675 predicted 2523
11 SASI_Mm01_00154356 predicted 2624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001166
VALIDATED
BIRC2 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-2714s1c1
Sequence:CCGGGCTGCGGCCAACATCTTCAAACTCGAGTTTGAAGATGTTGGCCGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001166.x-1567s1c1
Sequence:CCGGACATTCATTATCTCCCACCTTCTCGAGAAGGTGGGAGATAATGAATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-3398s1c1
Sequence:CCGGGCCGAATTGTCTTTGGTGCTTCTCGAGAAGCACCAAAGACAATTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001166.x-1685s1c1
Sequence:CCGGCCCTACAGTTATGCAATGAGTCTCGAGACTCATTGCATAACTGTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-2343s1c1
Sequence:CCGGTGGTTAAATCTGCCTTGGAAACTCGAGTTTCCAAGGCAGATTTAACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001166.3-2654s21c1
Sequence:CCGGACAACTGGAGAGAACTATAAACTCGAGTTTATAGTTCTCTCCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-2571s21c1
Sequence:CCGGTGAATACACCTGTGGTTAAATCTCGAGATTTAACCACAGGTGTATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001166.3-3512s21c1
Sequence:CCGGACTGCTTGTTATGCATCATTTCTCGAGAAATGATGCATAACAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-1718s21c1
Sequence:CCGGTATCCTAGCTGTAGCTTTATTCTCGAGAATAAAGCTACAGCTAGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001166.3-2508s21c1
Sequence:CCGGATGCTGACCCACCAATTATTCCTCGAGGAATAATTGGTGGGTCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-3238s21c1
Sequence:CCGGTCGTACATTTCTCTCTTAAAGCTCGAGCTTTAAGAGAGAAATGTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001166.3-3376s21c1
Sequence:CCGGAGTCTGCTTTGGTACTAATAACTCGAGTTATTAGTACCAAAGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-2295s21c1
Sequence:CCGGGTCGCAATGATGATGTCAAATCTCGAGATTTGACATCATCATTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001166
VALIDATED
BIRC2 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-2714s1c1
Sequence:CCGGGCTGCGGCCAACATCTTCAAACTCGAGTTTGAAGATGTTGGCCGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001166.x-1567s1c1
Sequence:CCGGACATTCATTATCTCCCACCTTCTCGAGAAGGTGGGAGATAATGAATGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-3398s1c1
Sequence:CCGGGCCGAATTGTCTTTGGTGCTTCTCGAGAAGCACCAAAGACAATTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001166.x-1685s1c1
Sequence:CCGGCCCTACAGTTATGCAATGAGTCTCGAGACTCATTGCATAACTGTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-2343s1c1
Sequence:CCGGTGGTTAAATCTGCCTTGGAAACTCGAGTTTCCAAGGCAGATTTAACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001166.3-2654s21c1
Sequence:CCGGACAACTGGAGAGAACTATAAACTCGAGTTTATAGTTCTCTCCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-2571s21c1
Sequence:CCGGTGAATACACCTGTGGTTAAATCTCGAGATTTAACCACAGGTGTATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001166.3-3512s21c1
Sequence:CCGGACTGCTTGTTATGCATCATTTCTCGAGAAATGATGCATAACAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-1718s21c1
Sequence:CCGGTATCCTAGCTGTAGCTTTATTCTCGAGAATAAAGCTACAGCTAGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001166.3-2508s21c1
Sequence:CCGGATGCTGACCCACCAATTATTCCTCGAGGAATAATTGGTGGGTCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-3238s21c1
Sequence:CCGGTCGTACATTTCTCTCTTAAAGCTCGAGCTTTAAGAGAGAAATGTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001166.3-3376s21c1
Sequence:CCGGAGTCTGCTTTGGTACTAATAACTCGAGTTATTAGTACCAAAGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-2295s21c1
Sequence:CCGGGTCGCAATGATGATGTCAAATCTCGAGATTTGACATCATCATTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001166
VALIDATED
BIRC2 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-2714s1c1
Sequence:CCGGGCTGCGGCCAACATCTTCAAACTCGAGTTTGAAGATGTTGGCCGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001166.x-1567s1c1
Sequence:CCGGACATTCATTATCTCCCACCTTCTCGAGAAGGTGGGAGATAATGAATGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-3398s1c1
Sequence:CCGGGCCGAATTGTCTTTGGTGCTTCTCGAGAAGCACCAAAGACAATTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001166.x-1685s1c1
Sequence:CCGGCCCTACAGTTATGCAATGAGTCTCGAGACTCATTGCATAACTGTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001166.x-2343s1c1
Sequence:CCGGTGGTTAAATCTGCCTTGGAAACTCGAGTTTCCAAGGCAGATTTAACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_001166.3-2654s21c1
Sequence:CCGGACAACTGGAGAGAACTATAAACTCGAGTTTATAGTTCTCTCCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-2571s21c1
Sequence:CCGGTGAATACACCTGTGGTTAAATCTCGAGATTTAACCACAGGTGTATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001166.3-3512s21c1
Sequence:CCGGACTGCTTGTTATGCATCATTTCTCGAGAAATGATGCATAACAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-1718s21c1
Sequence:CCGGTATCCTAGCTGTAGCTTTATTCTCGAGAATAAAGCTACAGCTAGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001166.3-2508s21c1
Sequence:CCGGATGCTGACCCACCAATTATTCCTCGAGGAATAATTGGTGGGTCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-3238s21c1
Sequence:CCGGTCGTACATTTCTCTCTTAAAGCTCGAGCTTTAAGAGAGAAATGTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001166.3-3376s21c1
Sequence:CCGGAGTCTGCTTTGGTACTAATAACTCGAGTTATTAGTACCAAAGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001166.3-2295s21c1
Sequence:CCGGGTCGCAATGATGATGTCAAATCTCGAGATTTGACATCATCATTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007465
VALIDATED
BIRC2 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-2696s1c1
Sequence:CCGGGCAGGACATTCTACTCTCTTTCTCGAGAAAGAGAGTAGAATGTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007465.1-1722s1c1
Sequence:CCGGCCTGGATAGAACACGCCAAATCTCGAGATTTGGCGTGTTCTATCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-1634s1c1
Sequence:CCGGGCTGGATTCTATTACGTGGATCTCGAGATCCACGTAATAGAATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-1491s1c1
Sequence:CCGGCCCACTGTCCATTTCTGGAAACTCGAGTTTCCAGAAATGGACAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007465.1-2268s1c1
Sequence:CCGGCCTTACAAGCAAGAGAGCTTACTCGAGTAAGCTCTCTTGCTTGTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-1722s21c1
Sequence:CCGGCTGGATAGAACACGCCAAATGCTCGAGCATTTGGCGTGTTCTATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2347s21c1
Sequence:CCGGGAAATTGACTCCACGTTATATCTCGAGATATAACGTGGAGTCAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-917s21c1
Sequence:CCGGTCTACCGAATGTCTACATATTCTCGAGAATATGTAGACATTCGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-1226s21c1
Sequence:CCGGTGTGCTCTAGCCCTCTTAATTCTCGAGAATTAAGAGGGCTAGAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2770s21c1
Sequence:CCGGTGTTGCAAGGGAAGGTCTATGCTCGAGCATAGACCTTCCCTTGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2434s21c1
Sequence:CCGGGAAGAGCAGTTGCGGAGATTACTCGAGTAATCTCCGCAACTGCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2708s21c1
Sequence:CCGGCTCTCTTTCAAGATTAGTAATCTCGAGATTACTAATCTTGAAAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-2270s21c1
Sequence:CCGGTACAAGCAAGAGAGCTTATTGCTCGAGCAATAAGCTCTCTTGCTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007465
VALIDATED
BIRC2 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-2696s1c1
Sequence:CCGGGCAGGACATTCTACTCTCTTTCTCGAGAAAGAGAGTAGAATGTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007465.1-1722s1c1
Sequence:CCGGCCTGGATAGAACACGCCAAATCTCGAGATTTGGCGTGTTCTATCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-1634s1c1
Sequence:CCGGGCTGGATTCTATTACGTGGATCTCGAGATCCACGTAATAGAATCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-1491s1c1
Sequence:CCGGCCCACTGTCCATTTCTGGAAACTCGAGTTTCCAGAAATGGACAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007465.1-2268s1c1
Sequence:CCGGCCTTACAAGCAAGAGAGCTTACTCGAGTAAGCTCTCTTGCTTGTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-1722s21c1
Sequence:CCGGCTGGATAGAACACGCCAAATGCTCGAGCATTTGGCGTGTTCTATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2347s21c1
Sequence:CCGGGAAATTGACTCCACGTTATATCTCGAGATATAACGTGGAGTCAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-917s21c1
Sequence:CCGGTCTACCGAATGTCTACATATTCTCGAGAATATGTAGACATTCGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-1226s21c1
Sequence:CCGGTGTGCTCTAGCCCTCTTAATTCTCGAGAATTAAGAGGGCTAGAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2770s21c1
Sequence:CCGGTGTTGCAAGGGAAGGTCTATGCTCGAGCATAGACCTTCCCTTGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2434s21c1
Sequence:CCGGGAAGAGCAGTTGCGGAGATTACTCGAGTAATCTCCGCAACTGCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2708s21c1
Sequence:CCGGCTCTCTTTCAAGATTAGTAATCTCGAGATTACTAATCTTGAAAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-2270s21c1
Sequence:CCGGTACAAGCAAGAGAGCTTATTGCTCGAGCAATAAGCTCTCTTGCTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007465
VALIDATED
BIRC2 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-2696s1c1
Sequence:CCGGGCAGGACATTCTACTCTCTTTCTCGAGAAAGAGAGTAGAATGTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007465.1-1722s1c1
Sequence:CCGGCCTGGATAGAACACGCCAAATCTCGAGATTTGGCGTGTTCTATCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-1634s1c1
Sequence:CCGGGCTGGATTCTATTACGTGGATCTCGAGATCCACGTAATAGAATCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007465.1-1491s1c1
Sequence:CCGGCCCACTGTCCATTTCTGGAAACTCGAGTTTCCAGAAATGGACAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007465.1-2268s1c1
Sequence:CCGGCCTTACAAGCAAGAGAGCTTACTCGAGTAAGCTCTCTTGCTTGTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-1722s21c1
Sequence:CCGGCTGGATAGAACACGCCAAATGCTCGAGCATTTGGCGTGTTCTATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2347s21c1
Sequence:CCGGGAAATTGACTCCACGTTATATCTCGAGATATAACGTGGAGTCAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-917s21c1
Sequence:CCGGTCTACCGAATGTCTACATATTCTCGAGAATATGTAGACATTCGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-1226s21c1
Sequence:CCGGTGTGCTCTAGCCCTCTTAATTCTCGAGAATTAAGAGGGCTAGAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2770s21c1
Sequence:CCGGTGTTGCAAGGGAAGGTCTATGCTCGAGCATAGACCTTCCCTTGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2434s21c1
Sequence:CCGGGAAGAGCAGTTGCGGAGATTACTCGAGTAATCTCCGCAACTGCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360405    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007465.2-2708s21c1
Sequence:CCGGCTCTCTTTCAAGATTAGTAATCTCGAGATTACTAATCTTGAAAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007465.2-2270s21c1
Sequence:CCGGTACAAGCAAGAGAGCTTATTGCTCGAGCAATAAGCTCTCTTGCTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)