EMAIL THIS PAGE TO A FRIEND

BIRC3

baculoviral IAP repeat containing 3

81 Gene Product Result for
Synonyms: AIP1 API2 CIAP2 HAIP1 HIAP1 MALT2 MIHC RNF49 c-IAP2
UniProtKB ID: Q13489, Q16628, Q9HC27, Q9UP46
Gene ID:
Human(330) Summary: This gene encodes a member of the IAP family of proteins that inhibit apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. The encoded protein inhibits apoptosis induced by serum deprivation but does not affect apoptosis resulting from exposure to menadione, a potent inducer of free radicals. It contains 3 baculovirus IAP repeats and a ring finger domain. Transcript variants encoding the same isoform have been identified. [provided by RefSeq, Aug 2011]
Mouse(11796) baculoviral IAP repeat-containing 3
Rat(78971) baculoviral IAP repeat-containing 3
domestic guinea pig(100713574) baculoviral IAP repeat containing 3
naked mole-rat(101719143) baculoviral IAP repeat containing 3
sheep(101120189) baculoviral IAP repeat containing 3
dog(489433) baculoviral IAP repeat containing 3
domestic cat(101083444) baculoviral IAP repeat containing 3
Horse(100068894) baculoviral IAP repeat containing 3
cow(514386) baculoviral IAP repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001165 Rosetta Predictions human pricing
NM_182962 Rosetta Predictions human pricing
NM_023987 Rosetta Predictions rat pricing
NM_007464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235507 predicted 4513
2 SASI_Hs01_00235508 predicted 3174
3 SASI_Hs01_00235509 predicted 3884
4 SASI_Hs01_00235510 predicted 3999
5 SASI_Hs01_00235511 predicted 3579
6 SASI_Hs01_00235512 predicted 4100
7 SASI_Hs01_00235513 predicted 3056
8 SASI_Hs01_00235514 predicted 3634
9 SASI_Hs02_00331281 predicted 4310
10 SASI_Hs01_00235515 predicted 3782
11 SASI_Hs01_00235506 predicted 3475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187068 predicted 1951
2 SASI_Hs01_00187069 predicted 616
3 SASI_Hs01_00187070 predicted 1329
4 SASI_Hs01_00187071 predicted 1439
5 SASI_Hs01_00187072 predicted 1011
6 SASI_Hs01_00187073 predicted 1545
7 SASI_Hs01_00187074 predicted 502
8 SASI_Hs01_00187075 predicted 1072
9 SASI_Hs02_00371106 predicted 1742
10 SASI_Hs01_00187076 predicted 1228
11 SASI_Hs01_00187067 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057761 predicted 737
2 SASI_Rn01_00057762 predicted 943
3 SASI_Rn01_00057763 predicted 739
4 SASI_Rn01_00057764 predicted 1800
5 SASI_Rn01_00057765 predicted 1002
6 SASI_Rn01_00057766 predicted 484
7 SASI_Rn01_00057767 predicted 748
8 SASI_Rn01_00057768 predicted 1248
9 SASI_Rn01_00057769 predicted 662
10 SASI_Rn01_00057770 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193170 predicted 1987
2 SASI_Mm01_00193171 predicted 1030
3 SASI_Mm02_00311673 predicted 951
4 SASI_Mm01_00193173 predicted 1857
5 SASI_Mm01_00193174 predicted 1975
6 SASI_Mm01_00193175 predicted 967
7 SASI_Mm01_00193176 predicted 1891
8 SASI_Mm02_00311674 predicted 445
9 SASI_Mm01_00193178 predicted 2057
10 SASI_Mm01_00193179 predicted 1231
11 SASI_Mm01_00193172 predicted 1066
12 SASI_Mm01_00193177 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001165
VALIDATED
BIRC3 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001165.3-4183s21c1
Sequence:CCGGTCTACTAACTGCCGGAATTATCTCGAGATAATTCCGGCAGTTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165.3-3542s21c1
Sequence:CCGGACACATGCAGCCCGCTTTAAACTCGAGTTTAAAGCGGGCTGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165.3-3578s21c1
Sequence:CCGGCCCTCTAGTGTTCTAGTTAATCTCGAGATTAACTAGAACACTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001165.3-2872s21c1
Sequence:CCGGGTACCGAATGTCTACGTATTCCTCGAGGAATACGTAGACATTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-3851s1c1
Sequence:CCGGGCAGAGTCATCAATTATCCATCTCGAGATGGATAATTGATGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-4821s1c1
Sequence:CCGGGCACTACAAACACAATATTCACTCGAGTGAATATTGTGTTTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001165.x-3775s1c1
Sequence:CCGGCCGTCAAGTTCAAGCCAGTTACTCGAGTAACTGGCTTGAACTTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-4575s1c1
Sequence:CCGGCAGTTCGTACATTTCTTTCATCTCGAGATGAAAGAAATGTACGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001165.x-3189s1c1
Sequence:CCGGGCTCTTATTCAAACTCTCCATCTCGAGATGGAGAGTTTGAATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001165
VALIDATED
BIRC3 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001165.3-4183s21c1
Sequence:CCGGTCTACTAACTGCCGGAATTATCTCGAGATAATTCCGGCAGTTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165.3-3542s21c1
Sequence:CCGGACACATGCAGCCCGCTTTAAACTCGAGTTTAAAGCGGGCTGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165.3-3578s21c1
Sequence:CCGGCCCTCTAGTGTTCTAGTTAATCTCGAGATTAACTAGAACACTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001165.3-2872s21c1
Sequence:CCGGGTACCGAATGTCTACGTATTCCTCGAGGAATACGTAGACATTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-3851s1c1
Sequence:CCGGGCAGAGTCATCAATTATCCATCTCGAGATGGATAATTGATGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-4821s1c1
Sequence:CCGGGCACTACAAACACAATATTCACTCGAGTGAATATTGTGTTTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001165.x-3775s1c1
Sequence:CCGGCCGTCAAGTTCAAGCCAGTTACTCGAGTAACTGGCTTGAACTTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-4575s1c1
Sequence:CCGGCAGTTCGTACATTTCTTTCATCTCGAGATGAAAGAAATGTACGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001165.x-3189s1c1
Sequence:CCGGGCTCTTATTCAAACTCTCCATCTCGAGATGGAGAGTTTGAATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001165
VALIDATED
BIRC3 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001165.3-4183s21c1
Sequence:CCGGTCTACTAACTGCCGGAATTATCTCGAGATAATTCCGGCAGTTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165.3-3542s21c1
Sequence:CCGGACACATGCAGCCCGCTTTAAACTCGAGTTTAAAGCGGGCTGCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165.3-3578s21c1
Sequence:CCGGCCCTCTAGTGTTCTAGTTAATCTCGAGATTAACTAGAACACTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001165.3-2872s21c1
Sequence:CCGGGTACCGAATGTCTACGTATTCCTCGAGGAATACGTAGACATTCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-3851s1c1
Sequence:CCGGGCAGAGTCATCAATTATCCATCTCGAGATGGATAATTGATGACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003776    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-4821s1c1
Sequence:CCGGGCACTACAAACACAATATTCACTCGAGTGAATATTGTGTTTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001165.x-3775s1c1
Sequence:CCGGCCGTCAAGTTCAAGCCAGTTACTCGAGTAACTGGCTTGAACTTGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_001165.x-4575s1c1
Sequence:CCGGCAGTTCGTACATTTCTTTCATCTCGAGATGAAAGAAATGTACGAACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001165.x-3189s1c1
Sequence:CCGGGCTCTTATTCAAACTCTCCATCTCGAGATGGAGAGTTTGAATAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007464
VALIDATED
BIRC3 MISSION shRNA Bacterial Glycerol Stock
baculoviral IAP repeat containing 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-1446s21c1
Sequence:CCGGGCTGGCTATCCTCATCTACTTCTCGAGAAGTAGATGAGGATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007464.3-2623s21c1
Sequence:CCGGGCATTTATGGTTCAGAAACTACTCGAGTAGTTTCTGAACCATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-951s21c1
Sequence:CCGGGCCAGATTACTCACCTATGAACTCGAGTTCATAGGTGAGTAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-1211s21c1
Sequence:CCGGCCGTATTAGAACATTCTCTAACTCGAGTTAGAGAATGTTCTAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1302s1c1
Sequence:CCGGGCTGGCTATCCTCATCTACTTCTCGAGAAGTAGATGAGGATAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-2479s1c1
Sequence:CCGGGCATTTATGGTTCAGAAACTACTCGAGTAGTTTCTGAACCATAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1845s1c1
Sequence:CCGGCCTGCGTTATACAGAGATATACTCGAGTATATCTCTGTATAACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007464.1-807s1c1
Sequence:CCGGGCCAGATTACTCACCTATGAACTCGAGTTCATAGGTGAGTAATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1067s1c1
Sequence:CCGGCCGTATTAGAACATTCTCTAACTCGAGTTAGAGAATGTTCTAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007464
VALIDATED
BIRC3 MISSION shRNA shRNA Plasmid DNA
baculoviral IAP repeat containing 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-1446s21c1
Sequence:CCGGGCTGGCTATCCTCATCTACTTCTCGAGAAGTAGATGAGGATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007464.3-2623s21c1
Sequence:CCGGGCATTTATGGTTCAGAAACTACTCGAGTAGTTTCTGAACCATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-951s21c1
Sequence:CCGGGCCAGATTACTCACCTATGAACTCGAGTTCATAGGTGAGTAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-1211s21c1
Sequence:CCGGCCGTATTAGAACATTCTCTAACTCGAGTTAGAGAATGTTCTAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1302s1c1
Sequence:CCGGGCTGGCTATCCTCATCTACTTCTCGAGAAGTAGATGAGGATAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-2479s1c1
Sequence:CCGGGCATTTATGGTTCAGAAACTACTCGAGTAGTTTCTGAACCATAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1845s1c1
Sequence:CCGGCCTGCGTTATACAGAGATATACTCGAGTATATCTCTGTATAACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007464.1-807s1c1
Sequence:CCGGGCCAGATTACTCACCTATGAACTCGAGTTCATAGGTGAGTAATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1067s1c1
Sequence:CCGGCCGTATTAGAACATTCTCTAACTCGAGTTAGAGAATGTTCTAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007464
VALIDATED
BIRC3 MISSION shRNA Lentiviral Transduction Particles
baculoviral IAP repeat containing 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-1446s21c1
Sequence:CCGGGCTGGCTATCCTCATCTACTTCTCGAGAAGTAGATGAGGATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007464.3-2623s21c1
Sequence:CCGGGCATTTATGGTTCAGAAACTACTCGAGTAGTTTCTGAACCATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-951s21c1
Sequence:CCGGGCCAGATTACTCACCTATGAACTCGAGTTCATAGGTGAGTAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007464.3-1211s21c1
Sequence:CCGGCCGTATTAGAACATTCTCTAACTCGAGTTAGAGAATGTTCTAATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1302s1c1
Sequence:CCGGGCTGGCTATCCTCATCTACTTCTCGAGAAGTAGATGAGGATAGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-2479s1c1
Sequence:CCGGGCATTTATGGTTCAGAAACTACTCGAGTAGTTTCTGAACCATAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1845s1c1
Sequence:CCGGCCTGCGTTATACAGAGATATACTCGAGTATATCTCTGTATAACGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007464.1-807s1c1
Sequence:CCGGGCCAGATTACTCACCTATGAACTCGAGTTCATAGGTGAGTAATCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007464.1-1067s1c1
Sequence:CCGGCCGTATTAGAACATTCTCTAACTCGAGTTAGAGAATGTTCTAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks